Strategies for the molecular genetic manipulation and visualization of the human fungal pathogen Penicillium marneffei

 

Kylie J. Boyce#, Hayley, E. Bugeja#, Harshini Weerasinghe, Michael J. Payne, Lena Schreider, Changwon Park, Trent Woodward and Alex Andrianopoulos

Department of Genetics, The University of Melbourne, Parkville, Victoria, Australia. (alex.a@unimelb.edu.au)

# These authors have contributed equally

 

 Fungal Genetics Reports 59: 1-12

(pdf)

 

P. marneffei has been established as an experimentally amenable system to study morphogenesis and pathogenicity. This paper describes the development of a number of tools, including numerous selectable markers, to expand the ease with which it can be genetically manipulated. Combined with strains engineered for homologous recombination of exogenous DNA, these tools facilitate efficient molecular genetic studies.


 

Introduction

To facilitate molecular genetic analysis of gene function in P. marneffei, an important opportunistic pathogen of humans, an efficient DNA-mediated transformation protocol was developed using exogenous DNA and polyethylene glycol-mediated protoplast fusion (Borneman et al. 2001). Spontaneous mutants were also derived from the P. marneffei type strain FRR2161 (ATCC18224) by selection on the toxic compounds 5-fluoroorotic acid (5-FOA) and chlorate to generate pyrG (orotidine 5’-monophosphate decarboxylase) auxotrophic and niaD (nitrate reductase) utilization mutants, respectively (Table 1 and 2)(Borneman et al. 2001). Combined with the dominant selectable marker of bleomycin/phleomycin resistance and the ability to recycle the pyrG marker (Borneman et al. 2001), complex genetically modified strains can be created for analysis. Exogenous DNA introduced during transformation preferentially integrates into the genome of P. marneffei by non-homologous integration, however, strains defective in the non-homologous end-joining machinery have recently been developed that result in highly efficient homologous integration (Table 1)(Bugeja et al, 2012). This study describes the development of additional auxotrophic and dominant selectable markers to broaden the options for selection of transformants containing introduced DNA in the type strain of P. marneffei or into clinical isolates (Table 2). In addition, a number of constructs have been developed for targeted integration at specific loci and for the rapid generation of gene deletion constructs using the previously described GatewayTM cloning system (Bugeja et al, 2012). Lastly, tools for the microscopic visualization of P. marneffei mutants generated by these techniques are described.

  

 Table 1. P. marneffei strains used in this study

Strain

Genotype

Origin

FRR2161

Wild type

Bamboo rat (Rhizomys sinensis) isolate (Supplied by J. Pitt, CSIRO Food Industries, Sydney, Australia). Also available from the American Type Culture Collection as ATCC18224

G146 (SPM3)

niaD1

(Borneman et al. 2001)

G147 (SPM4)

niaD1 pyrG1

(Borneman et al. 2001)

G809

niaD1 pyrG1 ∆ligD::AnpyrG+

(Bugeja et al, 2012)

G816

niaD1 pyrG1 ∆ligD

(Bugeja et al, 2012)

G779

niaD1 pyrG1 ∆riboB::AnpyrG

This study

G829

niaD1 pyrG1 ∆ligD riboB::AnpyrG

This study

G780

niaD1 pyrG1 ∆riboB

This study

G890

niaD1 pyrG1 ∆ligD riboB

This study

G830

niaD1 pyrG1 ∆ligD pyroA::AnpyrG

This study

G908

niaD1 pyrG1 ∆ligD pyroA

This study

G487

niaD1 pyrG1 areA∆DBD

This study

G831

niaD1 pyrG+ HI::mCherry ∆ligD

This study

 The riboB and pyroA selectable markers in P. marneffei

In order to develop additional selectable markers for use with auxotrophic P. marneffei strains, the riboB and pyroA genes encoding a GTP cyclohydrolase and 5’-phosphate synthase required for riboflavin and pyridoxine biosynthesis, respectively, were cloned and deleted (Oakley et al. 1987b; Osmani et al. 1999). The P. marneffei riboB gene was PCR amplified (primers AA18 and AA19) and cloned into pBluescript II SK+ (Stratagene)(pAA7329, Table 3 and 4). A split marker construct was generated by overlap PCR to facilitate deletion of the riboB locus using the A. nidulans pyrG blaster cassette (pHB7131 and pHB7132; Tables 3 and 4). A riboB gene deletion strain, in which the entire coding region has been replaced with the A. nidulans pyrG blaster cassette, was been generated in the SPM4 (G779) and ∆ligD pyrG- (G829) strains (Table 1). pyrG-­ derivatives (G780 and G890) have also been isolated as 5-FOA resistant sectors which have lost the A. nidulans pyrG gene (Borneman et al. 2001). P. marneffei ∆riboB strains require supplementation with 5 µg mL-1 riboflavin and must be grown in the dark to prevent photolytic breakdown of riboflavin (Table 2).

Table 2. P. marneffei selectable marker systems

Selectable marker

Recipient strain

Phenotype of recipient strain

Selection regime

pyrG

pyrG1

Uracil auxotroph

(requires 10 mM uracil),

5’FOA resistant

Positive: No added uracil

Negative: 1 mg mL-1 5-FOA + 10 mM uracil

niaD

niaD1

Nitrate utilization defect,

Chlorate resistant

Positive: 10 mM nitrate as the sole nitrogen source

Negative: 10 mM chlorate

riboB

DriboB

Riboflavin auxotroph (requires 5 µg mL-1 riboflavin & growth in dark)

No added riboflavin

pyroA

DpyroA

Pyridoxine auxotroph (requires 1 µg mL-1 pyridoxine)

No added pyridoxine

barA

Any

N/A

25-50 µg mL-1 of PPT

ptrA

Any

N/A

0.1-0.2 mg mL-1 of pyrithiamine hydrobromide

barA/hv-tk

Any

N/A

Positive: 25-50 µg mL-1 of PPT

Negative: 5 µM FDU

areA

areA∆DBD

Reduced growth on nitrogen sources other than ammonium

10 mM nitrite as the sole nitrogen source

wA

Any

Green conidiation

Screen for white conidiation phenotype

The P. marneffei pyroA gene was amplified (primers AA20 and AA21), cloned (pAA7331) and a split marker gene deletion construct was generated using overlap PCR (pHB7129 and pHB7130; Table 3 and 4). A pyroA gene deletion strain, in which the entire coding region has been replaced with the A. nidulans pyrG blaster cassette, was generated in the ∆ligD pyrG- strain (G830) and a pyrG- derivative (G908) has also been obtained as described above (Borneman et al. 2001). Similar to A. nidulans, the P. marneffei ∆pyroA strain requires supplementation with 1µg mL-1 pyridoxine (Table 2). Despite supplementation, it has been observed that this strain grows slower than pyroA+ strains and has slightly reduced conidiation at 25°C.

 

 Employing dominant selectable markers for transformation of P. marneffei

Since it was first developed as a dominant selectable marker in N. crassa, L-phosphinothricin (PPT), also known as glufosinate ammonium, resistance has been used in many fungi (Ahuja and Punekar 2008; Avalos et al. 1989). L-phosphinothricin inhibits glutamine synthetase, required for ammonium assimilation, by occupying the substrate (glutamate) pocket (Gill and Eisenberg 2001). The Aspergillus oryzae barA gene encodes PPT resistance and can be used in P. marneffei for transformation (Table 5). Similar to A. nidulans and N. crassa, selection of P. marneffei PPT resistant transformants requires approximately 25-50 µg mL-1 of PPT (Table 2)(Ahuja and Punekar 2008).

Table 3. Oligonucleotides used in this study

 

Name

Template

Sequence 5’ – 3’

AA18

riboB

CAGCGTGTCGAGTTCAGG

AA19

riboB

TCTCTCTCCATCAGCGGC

CC63

riboB

AAGGGTGAACACTATCCTTGCGGAGCGATGT

CC64

riboB

CCGTACATCGCTCCGCAAGGATAGTGTTCAC

CC65

riboB

GATGAGTGGCAGGGGGCTGCAGAAAGGTATA

CC66

riboB

CTCCTTATACCTTTCTGCAGCCCCCTGCCAC

QQ11

riboB

TGACCATGATTACGCCAAGC

QQ12

riboB

TGAATTCGAGCTCGGTACCC

AA20

pyroA

TCAAGCCGTTACTGTCCA

AA21

pyroA

GACTTTGAACGGCACATT

CC59

pyroA

AAGGGTGAACACTATCCATTCTCGGATGCCATTGC

CC60

pyroA

GCAATGGCATCCGAGAATGGATAGTGTTCACCCTT

CC61

pyroA

GATGAGTGGCAGGGGGCTATTGGCGTTAAGCGGTGG

CC62

pyroA

CCACCGCTTAACGCCAATAGCCCCCTGCCACTCATC

NN61

ptrA

TTACGGGATCCCATTGGTAA

NN62

ptrA

AAGACAAATCCGGTTCATGC

AA52

pyrG

CTTATCGGGCCGGAGCA

AA53

pyrG

ATCCTCGCTCTCCTCTTTCT

HH81

pyrG

GAGTTTGTCGTGCTATCCG

II01

pyrG

GTCTTGCTTACGGTACTCC

QQ39

pyrG

CGCAAACTATTCGCTACTG

KK77

niaD

CGAAACCAAGACGAGAGGC

KK78

niaD

TTGGATGGGAAGAGAGCG

II08

wA

AATCTAGAGCCTATGCCTATGTCTTC

II09

wA

AAGCGGCCGCGAATGCGACAGGCGTATC

HH45

wA

GTCATGCAGGAAAGGGTCAT

HH46

wA

GCACCGGTCGATACTTGAAT

LL9

mCherry

ACTAGTGCCGGTGCGCCCGGG

LL10

mCherry

TCTAGACCAGCATCTGATGTCCTGGT

LL11

H1

GGATCCCCCTTGACAAAACCGCAGAG

LL12

H1

ACTAGTGGCCTTCTTGGGTGTGGCCT

MM8

pDONRTM221-attP2

TGAGGACAATAGCGAGTAGG

MM9

pDONRTM221-attP1

TGAGGACAATAGCGAGTAGG

 

Table 4. Plasmids used in this study

 

Plasmid

Name

Description

pPL3

An riboB

A. nidulans riboB gene (Oakley et al. 1987b)

pAA7329

riboB

riboB gene amplified using AA18 and AA19 and cloned into the EcoRV site of pBluescript SK+

pHB7131

5’∆riboB::pyrG

5’ riboB fused to the 5’ half of pyrG. Overlap PCR using AA18, CC63, CC64 and AA52. Amplify using AA18 and AA52.

pHB7132

3’∆riboB::pyrG

3’ riboB fused to the 3’ half of pyrG. Overlap PCR using CC65, AA19, CC66 and AA53. Amplify using AA19 and AA53.

pAA7331

pyroA

pyroA gene amplified using AA20 and AA21 and cloned into the EcoRV site of pBluescript II SK+ (Osmani et al. 1999).

pHB7129

5’∆pyroA::pyrG

5’ pyrA fused to the 5’ half of pyrG. Overlap PCR using AA21, CC59, CC60 and AA52. Amplify using AA21 and AA52.

pHB7130

3’∆pyroA::pyrG

3’ pyroA fused to the 3’ half of pyrG. Overlap PCR using AA20, CC61, CC62 and AA53. Amplify using AA20 and AA53.

pAA5962

MT1612

barA

pTW7703

ptrA SK+

A. oryzae ptrA PCR amplified from PTRII using primers NN61 and NN62 and cloned into the SmaI site of pBluescript II SK+.

pTW7704

ptrA SK+

Same as pTW7703 with insert in opposite orientation.

pTW7705

ptrA SK+ backbone

A. oryzae ptrA PCR amplified from PTRII using primers NN61 and NN62 and blunt cloned into the SspI site of the pBluescript II SK+ backbone.

pDG18

trpC(p)::hv-tk::trpC(t)

Contains the hv-tk gene encoding herpes simplex virus thymidine kinase under the control of the A. nidulans trpC promoter and terminator (Gardiner and Howlett 2004).

pKB7410

pyrG (2161) pGTE

pyrG cloned from strain FRR2161 (pyrG+) using primers HH81 and II01 and cloned into pGEM-T Easy.

pKB7411

pyrG (SPM4) pGTE

pyrG cloned from strain SPM4 (pyrG-) using primers HH81 and II01 and cloned into pGEM-T Easy.

pLS7804

pyrG targeting

P. marneffei pyrG (missing 60 bp of coding region) amplified with QQ39 and II01, digested with EcoICRI and cloned into the SspI sites of the pBluescript II SK+ backbone.

pHB7612

P. marneffei niaD

niaD was PCR amplified using KK77 and KK78 and cloned into pBluescript II SK+.

pHB7613

niaD targeting

EcoRI fragment deletion to remove the 5’ 546 bp of niaD to allow targeted integration.

pHB7615

niaD targeting SK+ backbone

2.8 kb EcoRI/HindIII fragment from pHB7613 was made blunt ended with Klenow and cloned into the SspI sites in the pBluescript II SK+ backbone.

pHB6104

areA

Full length areA gene (Bugeja et al, 2012b)

pHB7186

areA targeting

2.6 kb EcoICRI/EcoRV fragment from pHB6104 cloned into the SspI sites of the pBluescript II SK+ backbone.

pSJ7351

wA pGTE

8.5 kb coding region of wA amplified using HH45 and HH46 and cloned into pGEM-T Easy.

pSB7364

wA targeting (pyrG+)

 A NotI fragment of a 1.7 kb wA PCR (amplified from pSB7351 using II08 and II09) was cloned into pALX223.

pDONRTM221

Gateway cloning vector

Invitrogen

pHW7711

pDONRTM221::pyrG

Bugeja et al, 2012

pHW7856, pHW7857.

pDONRTM221 ::pyroA

 

Inverse PCR of pDONRTM221 with the MM8 and MM9 primers ligated to the pyroA fragment from pAA7331. pyroA selectable marker available in both orientations.

pHW7771, pHW7772

pDONRTM221 ::barA

 

Inverse PCR of pDONRTM221 with the MM8 and MM9 primers ligated to the 1443 bp EcoRV barA fragment from pAA5962. barA selectable marker available in both orientations.

pHW7773,

pHW7774

pDONRTM221 ::riboB

 

Inverse PCR of pDONRTM221 with the MM8 and MM9 primers ligated to a 2663 bp AnriboB PCR product from pPL3 amplified using the primers QQ11 and QQ12. AnriboB selectable marker available in both orientations.

pMP7742

pDONRTM221 ::ptrA

Inverse PCR of pDONRTM221 with the MM8 and MM9 primers ligated to an EcoICRI/EcoRV ptrA fragment from pTW7703.

pMP7601

mCherry pGTE

mCherry PCR amplified from LO1945 (Supplied by B. Oakey) using LL09 and LL10 and cloned into pGEM-T Easy.

pMP7602

H1 pGTE

Histone H1 PCR amplified from FRR2161 genomic DNA with LL11 and LL12, which adds a 5’ BamH1 site and a 3’ SpeI site, removes the stop codon and contains 1.7 kb of promoter.

pMP7605

H1(p)::H1::mCherry pyrG

BamHI/SpeI pMP7602 ligated to BamHI/SpeI pALX223. This clone was digested with SpeI/XbaI and ligated to SpeI/XbaI fragment from pMP7601.

 

 

Table 5. Plasmids for use in the selectable marker systems

 

Selectable marker

Plasmid

Description

Reference

pyrG

pAA4707

A. nidulans pyrG

(Oakley et al. 1987a)

 

pAB4626

A. nidulans pyrG blaster cassette

(Borneman et al. 2001)

 

pHW7711

GatewayTM plasmid containing A. nidulans pyrG blaster cassette flanked by attP sites

(Bugeja et al, 2012)

 

pSB7364

wA targeting construct contains A. nidulans pyrG blaster cassette

This study

 

pLS7804

pyrG targeting construct

This study

niaD

pSTA14

A. oryzae niaD

(Unkles et al. 1989)

 

pHB7613, pHB7615

niaD targeting construct

This study

riboB

pPL3

A. nidulans riboB gene

(Oakley et al. 1987b)

 

pHW7773,

pHW7774

GatewayTM plasmid containing A. nidulans riboB gene flanked by attP sites

This study

pyroA

p14

A. nidulans pyroA gene

(Osmani et al. 1999)

barA

pSM6287

A. oryzae barA gene

(Nayak et al. 2006)

 

pHW7771, pHW7772

GatewayTM plasmid containing A. oryzae barA gene flanked by attP sites

This study

ptrA

pTW7703-7705

A. oryzae ptrA gene

This study

 

pMP7742

GatewayTM plasmid containing A. oryzae ptrA gene flanked by attP sites

This study

barA/hv-tk

pHW7591

Plasmid containing A. oryzae barA for positive selection and hv-tk for negative selection

This study

areA

pHB7186

areA targeting construct

This study

 

Pyrithiamine resistance was first developed as a dominant selectable marker in A. oryzae and has since been shown to be effective in a number of filamentous fungi (Kubodera et al. 2000; Kubodera et al. 2002). Pyrithiamine is a thiamine analogue, that binds to thiamine pyrophosphate riboswitches, small RNA elements that bind thiamine pyrophosphate to regulate the expression of genes required for the biosynthesis and transport of thiamine, an essential cofactor (Sudarsan et al. 2005). Pyrithiamine resistance can also be utilized as a dominant selectable marker for transformation in P. marneffei as ptrA containing plasmids (Table 5) confer resistance to pyrithiamine, with transformants selected on 0.1-0.2 mg mL-1 of pyrithiamine hydrobromide (Sigma)(Table 2). Occasionally, a low number of spontaneously resistant colonies can arise during transformation without the addition of exogenous DNA.

 

Selectable marker plasmids facilitating positive/negative selection

In circumstances where constructs may be transiently required, certain selectable markers may also be used for negative selection of constructs. This has been demonstrated previously for recycling of the pyrG selectable marker (Borneman et al. 2001). Both the pyrG and niaD genes facilitate negative selection, in addition to positive selection, since mutations cause resistance to the toxic compounds 5-fluoroorotic acid (5-FOA) or chlorate, respectively (Table 2). A new construct has been developed which can also be used for both positive and negative selection (pHW7709, Table 5). This construct contains the previously described barA gene, used as a positive selectable marker and the ‘dominant’ Herpes Simplex virus thymidine kinase encoding gene (hv-tk) as a negative selectable marker, which confers sensitivity to the toxic thymidine analogue 5-fluorodeoxyuridine (FDU) (Table 2 and 5) (Sachs et al, 1997; Ahuja and Punekar 2008; Gardiner and Howlett 2004; Gill and Eisenberg 2001). To counter-select against hv-tk, strains are plated on medium containing 5 µM 5-fluorodeoxyuridine (FDU)(Sigma). Southern blot hybridisation analysis should be used to confirm loss of the constructs containing the negative selectable markers, as opposed to point mutations that could result in the same phenotype, albeit at a lower frequency.

 

Targeted integration of plasmids

Targeted integration of constructs at specific loci offers many advantages over non-specific ectopic integration by overcoming possible copy number and position effects. A series of targeting constructs were generated to allow for the integration of plasmids at known genomic locations, including pyrG, areA, niaD and wA (Table 6). When a recipient strain is transformed with the appropriate targeting plasmid, a single homologous recombination event leads to the integration of the plasmid thus restoring gene function (pyrG, areA and niaD) or resulting in a visible phenotype (wA) (Figure 1). Ectopic integration will not result in these selected phenotypes. The plasmids used for targeted integration at pyrG, niaD or areA all contain a portion of the selectable marker cloned into the SspI sites of the pBluescript II SK+ backbone to permit blue/white screening to be used when additional DNA fragments are cloned into the polylinker (Table 4).

The pyrG- and niaD- mutations in strain SPM4 (G147) were identified by sequencing of the PCR products spanning these genes (Table 6). Plasmids for pyrG and niaD targeting lack the start codon of these genes but contain the regions that span the loss-of-function point mutations. Thus, a single crossover event between the start codon and the mutated region of the genomic allele leads to integration of the plasmid and restoration of gene function, that is the ability to grow in the absence of uracil or on nitrate as a sole nitrogen source (Table 2).

 

Table 6. P. marneffei gene targeting regimes

Gene targeted

Recipient strain

Nature of mutation in recipient strain

Region of gene sequence included for targeting

pyrG

pyrG-

L155V and I156T in the decarboxylase domain

Contains all but first 60 bp of pyrG coding sequence (pLS7804)

wA

Any with green conidiationa

 

N/A

Internal portion (+19 to +932) of the wA coding sequence (pSB7364)

areA

areA∆DBD

Deletion of DNA binding domain

Contains 3’ half of areA including DNA binding domain but lacks the START codon (pHB7186)

niaD

niaD-

N293K and K513N

Contains all but first 546 bp of niaD coding sequence (pHB7615)

 a Requires additional selection. Transformants with integration at wA locus will display a white conidiation phenotype

Additionally, the areA gene, encoding the GATA transcription factor required for growth on non-preferred nitrogen sources, was also developed as a locus for targeted integration (Bugeja et al, 2012b). This locus displays a high-rate of homologous integration and has been modified such that the DNA-binding domain has been deleted (areA∆DBD), resulting in loss of gene function, yet the majority of the coding region is still intact. A plasmid containing the 3’ half of areA, including the DNA-binding domain is used for targeted integration (Table 6). When areA∆DBD strains are transformed with the areA targeting plasmid, a single crossover event integrates the plasmid at areA thus restoring the ability to utilise non-preferred nitrogen sources (Table 2, Figure 1). Screening integration events by Southern blot analysis is crucial as a double crossover or gene conversion events are also possible and will lead to areA+ without integrating the entire plasmid (Figure 1).

Figure 1. Targeting to the areA locus in the areA∆DBD strain

The plasmid for gene targeting to the areA locus contains a 5’ truncated allele of the areA gene (grey shading). When areA∆DBD strains are transformed with the areA targeting plasmid, a single recombination event will integrate the plasmid into the genomic region containing the areA∆DBD locus (black shading) via a single crossover event (solid cross) in the homologous region 5’ of the DBD deletion (hatched box). This will regenerate a wild-type areA+ gene thus restoring the ability to utilise nitrite as the sole nitrogen source, in addition to, a copy of areA that contains both the 5’ truncation and the DBD deletion flanking the integrated vector sequences. The dashed cross depicts an alternate homologous recombination event that may also occur to regenerate a wild-type areA+ gene without integration of the vector sequences.

 

The polyketide synthase encoding gene, wA (pksP), is required for DHN melanin synthesis during asexual development, resulting in pigmentation of the asexual spores (conidia), which can be detected visually at the colony level (Mayorga and Timberlake 1990; Mayorga and Timberlake 1992) (Table 6). The P. marneffei wA targeting construct contains an internal portion of the wA coding sequence, in addition to the A. nidulans pyrG selectable marker (Table 4). Transformants of pyrG- recipient strains are selected for uracil prototrophy (pyrG+), and secondarily screened for a white conidial phenotype indicating that the construct has integrated via a single cross over event at the wA locus resulting in gene disruption (Table 6). It should be noted that A. fumigatus pksP (orthologous to wA) mutants display decreased virulence in a mouse model of aspergillosis and P. marneffei disruption mutants also have attenuated virulence (Jahn et al. 2000; Jahn et al. 2002; Langfelder et al. 1998; Woo et al. 2010). Therefore P. marneffei wA targeting should not be utilized in strains that will be subsequently tested for virulence attributes.

 

Selectable markers available for the generation of deletion constructs using a GatewayTM cloning system

A pipeline for the cloning and functional characterization of genes in P. marneffei utilizing a GatewayTM cloning system to facilitate the rapid generation of gene deletion constructs has been developed (Bugeja et al, 2012). This approach uses a PCR and recombination based system where the flanking regions of genes to be deleted are amplified by inverse PCR to incorporate attB recognition sequences, which facilitates integration of a selectable marker by in vitro recombination with corresponding attP sequences. GatewayTM plasmids containing A. nidulans pyrG (pHW7711; Figure 2A), riboB (pHW7771 and pHW7772; Figure 2B), pyroA (pHW7856 and pHW7857, Figure 2C) and A. oryzae barA (pHW7773 and pHW7774; Figure 2D) and ptrA (pMP7742; Figure 2E) have been constructed to allow the rapid generation of deletion constructs (Table 4). These plasmids (which confer kanamycin resistance in E.coli) have been engineered to contain the selectable marker gene flanked by attP1 and attP2 sites. The nature of the selectable markers means that these constructs can also be used in fungi other than P. marneffei.

 

Figure 2. Plasmids for the generation of deletion constructs using a GatewayTM cloning system

Plasmids contain kanamycin resistance (KanR) and a selectable marker flanked by attP1 and attP2 sites. Selectable markers: A. A. nidulans pyrG (pHW7711), B. riboB (pHW7771), C. pyroA (pHW7856) and D. A. oryzae barA (pHW7773) and E. ptrA (pMP7742). Plasmids containing riboA, pyroA and barA are available with selectable markers in both orientations.

 

 

Tools for microscopic visualization of P. marneffei

P. marneffei mutants generated using the molecular tools described above are commonly characterized for morphological defects microscopically by observing hyphae, conidiophores and yeast cells. A number of cellular stains and fluorescent fusion proteins can be used to allow microscopic visualization of the cell membrane or wall and nuclei. For microscopic visualization, P. marneffei strains can be grown as liquid cultures in shake flasks or microtitre plates, or on slides covered with a thin layer of solid medium with one end resting in liquid medium (Borneman et al. 2000). When required cells can be fixed by soaking them in a solution of 4% para-n-formaldehyde in PME (50 mM PIPES pH 6.7, 1 mM MgSO4, 20 mM EGTA) for 30 minutes, followed by two 5 minute PME washes.

 P. marneffei cell membranes can be visualized using the lipophylic membrane dye FM4-64 (Invitrogen) and is performed by immersing unfixed slides in 25 mM FM4-64 (suspended in water) for 15 minutes at room temperature, washing and mounting in water. In the wild type, FM4-64 staining is observed around the cell periphery, surrounding vesicles at the hyphal apex, as a crescent at the presumptive Spitzenkorper and as transverse membranes partitioning the hyphae into separate cellular compartments at septation sites (Figure 3A and B). Membrane sterols can be visualized using the fluorescent polyene macrolide stain, filipin, which specifically intercalates into sterol-rich membranes (Van Leeuwen et al. 2008). Sterol staining is performed by immersing unfixed cells in 5 mL of 25 mg mL-1 filipin (stock 1 mg mL-1 in DMSO, Sigma) for 5 minutes, followed by washing with liquid medium and visualization under UV. In wild type, ergosterol staining is observed concentrated at the hyphal apex, at the plasma membrane including at septa and as spots along the length of the hyphae (Figure 3C and D).

Figure 3. Microscopic visualization of P. marneffei

Wild type P. marneffei grown for 3 days at 25°C and stained with FM4-64 (A-B), Filipin (C-D), Calcofluor white (CAL)(E) or DAPI (F). Images were captured using differential interference contrast (DIC) or with epifluorescence to observe fluorescent stains. Scale bars, 20 mm.

Fluorescent brightener 28 (calcofluor white, Sigma) and FITC conjugated lectin (wheat germ agglutinin, WGA, Molecular Probes) can be used to visualize cell walls under UV (Figure 3E). Calcofluor is a non-specific fluorochrome which binds both cellulose and chitin in fungal cell walls, whereas, WGA specifically detects glycoproteins containing ß(1-4)-N-acetyl-D-glucosamine. For calcofluor white staining, 1 µL of a 1 µg µL-l calcofluor white solution (suspended in water) is added directly to 5 µL of Tween 80 on the microscope coverslip prior to mounting. A modified protocol for WGA staining can be performed on live or fixed cells (Robin et al. 1986). Prior to staining, slides are incubated for 5 minutes in PME, 15 minutes in PME with 1 µg µL-1 BSA and then washed in PME. A 5 µL drop of a 5 µg µL-l WGA solution (suspended in water) is added to the coverslip and slides are incubated in the dark for 30 minutes, before being washed with PME and mounted.

Under UV light nuclei can be observed in fixed P. marneffei cells stained with either 4,6-diamidino-2.phenylindole (DAPI) or Hoescht 33342 (Figure 3F). 1 µL of a 1 µg µL-l solution of either stain (suspended in water) is added directly to 5 µL of Tween 80 on the coverslip prior to mounting. Nuclei can also be visualized using the HI::mCherry construct (pMP7605), which contains a fusion between the Histone HI and the mCherry fluorescent protein encoding gene (Table 4). A DligD pyrG- HI::mCherry strain is also available as a transformation recipient strain (Table 2).

Combined with strains engineered for homologous recombination of exogenous DNA, the constructs for ectopic or site-specific integration and rapid generation of gene deletion constructs described in this study will greatly facilitate rapid and efficient analysis of gene function in P. marneffei and are available through the Fungal Genetics Stock Center (FGSC).

 

Acknowledgments

This work was supported by grants from the National Health and Medical Research Council of Australia and the Howard Hughes Medical Institute.

 

References

Ahuja, M., Punekar, N.S., 2008. Phosphinothricin resistance in Aspergillus niger and its utility as a selectable transformation marker. Fungal Genet Biol. 45, 1103-10.

Avalos, J., et al., 1989. Bialaphos resistance as a dominant selectable marker in Neurospora crassa. Curr Genet. 16, 369-72.

Borneman, A.R., et al., 2000. The abaA homologue of Penicillium marneffei participates in two developmental programmes: conidiation and dimorphic growth. Mol Microbiol. 38, 1034-47.

Borneman, A.R., et al., 2001. An STE12 homolog from the asexual, dimorphic fungus Penicillium marneffei complements the defect in sexual development of an Aspergillus nidulans steA mutant. Genetics. 157, 1003-14.

Bugeja, H.E., et al., 2012. Tools for high efficiency genetic manipulation of the human pathogen Penicillium marneffei. Fungal Genetics Biol. In press.

Bugeja, H.E., et al., 2012b. AreA controls nitrogen source utilisation during both growth programs of the dimorphic fungus Penicillium marneffei. Fungal Biol. 116, 145-54.

Gardiner, D.M., Howlett, B.J., 2004. Negative selection using thymidine kinase increases the efficiency of recovery of transformants with targeted genes in the filamentous fungus Leptosphaeria maculans. Curr Genet. 45, 249-55.

Gill, H.S., Eisenberg, D., 2001. The crystal structure of phosphinothricin in the active site of glutamine synthetase illuminates the mechanism of enzymatic inhibition. Biochem. 40, 1903-12.

Jahn, B., et al., 2000. Interaction of human phagocytes with pigmentless Aspergillus conidia. Infect Immun. 68, 3736-9.

Jahn, B., et al., 2002. PKSP-dependent reduction of phagolysosome fusion and intracellular kill of Aspergillus fumigatus conidia by human monocyte-derived macrophages. Cell Microbiol. 4, 793-803.

Kubodera, T., et al., 2000. Pyrithiamine resistance gene (ptrA) of Aspergillus oryzae: cloning, characterization and application as a dominant selectable marker for transformation. Biosci Biotechnol Biochem. 64, 1416-21.

Kubodera, T., et al., 2002. Transformation of Aspergillus sp. and Trichoderma reesei using the pyrithiamine resistance gene (ptrA) of Aspergillus oryzae. Biosci Biotechnol Biochem. 66, 404-6.

Langfelder, K., et al., 1998. Identification of a polyketide synthase gene (pksP) of Aspergillus fumigatus involved in conidial pigment biosynthesis and virulence. Med Microbiol Immunol. 187, 79-89.

Mayorga, M.E., Timberlake, W.E., 1990. Isolation and molecular characterization of the Aspergillus nidulans wA gene. Genetics. 126, 73-9.

Mayorga, M.E., Timberlake, W.E., 1992. The developmentally regulated Aspergillus nidulans wA gene encodes a polypeptide homologous to polyketide and fatty acid synthases. Mol Gen Genet. 235, 205-12.

Nayak, T., et al., 2006. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics. 172, 1557-66.

Oakley, B.R., et al., 1987a. Cloning, mapping and molecular analysis of the pyrG (orotidine-5'-phosphate decarboxylase) gene of Aspergillus nidulans. Gene. 61, 385-99.

Oakley, C.E., et al., 1987b. Cloning of the riboB locus of Aspergillus nidulans. Gene. 53, 293-8.

Osmani, A.H., et al., 1999. The extremely conserved pyroA gene of Aspergillus nidulans is required for pyridoxine synthesis and is required indirectly for resistance to photosensitizers. J Biol Chem. 274, 23565-9.

Robin, J.B., et al., 1986. Rapid visualization of three common fungi using fluorescein-conjugated lectins. Invest Ophthalmol Vis Sci. 27, 500-6.

Sachs, M.S., et al, 1997. Expression of herpes virus thymidine kinase in Neurospora crassa. Nucleic Acids Res. 25, 2389-95.

Sudarsan, N., et al., 2005. Thiamine pyrophosphate riboswitches are targets for the antimicrobial compound pyrithiamine. Chem Biol. 12, 1325-35.

Unkles, S.E., et al., 1989. Transformation of Aspergillus niger with the homologous nitrate reductase gene. Gene. 78, 157-66.

Van Leeuwen, M.R., et al., 2008. Filipin is a reliable in situ marker of ergosterol in the plasma membrane of germinating conidia (spores) of Penicillium discolor and stains intensively at the site of germ tube formation. J Microbiol Methods. 74, 64-73.

Woo, P.C., et al., 2010. High diversity of polyketide synthase genes and the melanin biosynthesis gene cluster in Penicillium marneffei. FEBS J. 277, 3750-8.