In the abstract to the Nature paper, they say that Magnaporthe is "... the principal model organism for elucidating the molecular basis of fungal disease of plants." My PERSONAL view is that there need not be a single dominant model. Each organism has something to offer, for example the understanding of AVR proteins in Cladosporium has greatly clarified how plants and fungal pathogens interact. Other examples of ground-breaking research into the plant-pathogen interactions with other fungi (and even Oomycetes) exist and are too numerous to list here. Molecular Plant-Microbe Interactions is a good place to start looking for more information. Nevertheless, the M. grisea genome paper is getting some press and what is good for one fungus is good for all fungi.
| We have received the Rhizopus oryzae strain sequenced at the Broad Institute. It is FGSC 9543 |
4/25/05
Help improve Aspergillus annotation and microarrays!
Scott Peterson and Jennifer Wortman will be heading the Aspergillus Annotation Blitz at TIGR. They have requested that all data be sent through me to make it easier for them to handle. For cDNAs and ESTs we need sequences in FASTA format with the gene identifier (if known) in the description line. For arrays we need sequences of oligos or amplicons in FASTA format with gene identifiers (if known) and whether a signal has been confirmed in the description line (see example below). Alternately the gene identifiers and whether the signal has been confirmed can be sent in an Excel spreadsheet or any tab-delimited text file. Data must be received by May 5, 2005 to be sure they get incorporated into the annotation.
Data will only be used for annotation improvement and will not be released to others. We are interested in 5', 3' and intron calls, not conditions under which the messages are expressed. The improved annotation will be made available to CADRE and Broad genome databases, but will not include expression profiles. This effort will result in the elimination of many of the fused genes and improper calls in the current annotation and will allow PFGRC to design better microarrays.
If you have questions or data to contribute email me before May 5 at momany@plantbio.uga.edu.
FASTA FORMAT (Adapted from http://ngfnblast.gbf.de/docs/fasta.html):
A sequence in FASTA format begins with a single-line description, followed by lines of sequence data.
The description line starts with a greater than symbol (">").
The word following the greater than symbol (">") immediately is the "ID" (name) of the sequence, the rest of the line is the description.
The "ID" and the description are optional.
All lines of text should be shorter than 80 characters.
The sequence ends if there is another greater than symbol (">") symbol at the beginning of a line and another sequence begins.
The following example contains two amplicon sequences (Amplicon1, Amplicon2), their gene designations and whether amplicon hybridization has been confirmed:
>Amplicon1|envelope protein|AN4417.1|confirmed
ACGTACCCTTGGGCAAATTTGGGCCCTCTCGTGTCTCTCTAAACCCCTTTGGGGGGGGGGG
CCCCGGGTTTATATATTAGGCGCGCGCGCGAATATATATTATATTATATTATATTATTAT
>Amplicon2|hypothetical|AN4370.1|unconfirmed CCGGCGCGAATTATACGCGCAGCGACGACGACCCCCGGGGTCTCTCTCTCTCGGGGGGCC AATTTGTTGTGTGACCATCTACTCAGACTTCATACTACTACTACTACTCTCTCTCTCTCTCTCT
Michelle Momany, PhD
Chair, Aspergillus Genome Research Policy Committee
Associate Professor
Department of Plant Biology
University of Georgia
Athens, GA 30602
Phone: (1) 706-542-2014
FAX: (1) 706-542-1805
Email: momany@plantbio.uga.edu
Webpage:http://www.plantbio.uga.edu/~momany/momany.html
Aspergillus niger Annotation call from Scott Baker
All those who would like to work on annotation of the Aspergillus niger genome should send me an email(scott.baker@pnl.gov). If there is a particular gene family of interest (e.g. actin, kinases, etc), that should be included in the email so that we will be ready to move forward in an organized way and more easily coordinate with JGI when the genome is assembled. I will send out an A. niger "newsletter" with updates regarding genome sequencing progress. Those who don't want to annotate but would still like to receive the newsletter should send me an email as well. As of April JGI is in production sequencing mode for the A. niger genome and have begun construction of the cDNA libraries for EST generation.
Next summer, FGSC technician Sheera Walker will attend the Fusarium workshop at Kansas State University.
4/19/05
2. Metzenberg wins the Morgan Medal!
Bob Metzenberg was the 2005 recipient of the GSA's prestigious award the Morgan Medal.
The Morgan medal was presented to Bob by David Perkins, at the Asilomar banquet.
3. Dunlap wins the new Metzenberg Award!
At the Asilomar meeting a new award was announced and presented in honour of the outstanding career achievements of Bob Metzenberg.
Nominees for this award on this occasion were provided by the NPC, although in the future nominations will be solicited from all the community.
The next award will be in 2007, and after that every 2-4 years at the discretion of the NPC. Nomination files were screened by a panel of well-known
researchers from inside and outside the Neurospora community. The Metzenberg Award has been accepted by the GSA as part of their official list of
prestigious awards. The award is to recognize Neurospora workers whose renown (like Bob's) has spread beyond Neurospora. (Full details can be found
online).
5. Announcing the new Neurospora Community Awards.
These awards will be in recognition of the fact that a significant part of the success of Neurospora as a model research organism is due to the collaborative
nature of its research community. Certain individuals have made exceptional contributions towards community, and these people will be acknowledged by the awards.
6. Fungal Genetics Policy Committee
At the Asilomar meeting, two Neurospora workers, John Taylor and Kathy Borkovich, were voted onto this committee, whose main job is to oversee the FG meetings.
9. Next Neurospora meeting
This will be at Asilomar March 30 - April 2, 2006. The programme committee will be Nora and Oded, who welcome suggestions for symposia and speakers.
Another call for names will be sent out later.
The NIH program director for the P01 (Laurie Tompkins) will be attending the meeting, so this will be a great chance to show off the full Neurospora community at work. (If there are people you know who are peripheral to the Neurospora community, but might be interested in attending to check things out, the NPC can provide letters of invitation.)
10. Three new important websites
a) Neurospora has finally taken its rightful place on the main NIH web page "Model Organisms for Biomedical Research". Go to http://www.nih.gov/science/models/ and click on
'Neurospora'.
b) GermOnline
This project on sexual reproduction of Neurospora crassa is an innovative paradigm for a community-based cross-species knowledge base.
It is freely accessible via the internet through a global network of servers in Asia, Europe and the USA. They invite the community
to make contributions on N. crassa genes relevant for meiosis, spore formation and spore germination. GermOnline integrates curated entries on genes and
microarray data relevant for the mitotic and meiotic cell cycle, gametogenesis and fertility across 11 model organisms and H. sapiens. After
a brief registration step, authors access an intuitive online form similar to those used by journals for uploading a manuscript. Contributions
are based upon at least one peer-reviewed paper. An entry consists of a title and a description, GeneOntology terms, images and/or figures
(jpeg less than 2MB; there is no copyright issue), optional information about experimentally verified homologues/orthologues of a given gene and the original
PubMed reference(s). Multiple entries from different labs working on the same gene are possible and encouraged. GermOnline also serves as an online database service for your microarray data that are displayed as a graph and in numerical form to support your paper.The project is funded by a long-term grant from the Swiss Institute of Bioinformatics (http://www.isb-sib.ch) and it has so far been greatly appreciated by people in the field. GermOnline is recognized as a reliable source of information by Uniprot, GRID, ISI Current Web Content and a growing number of species-specific databases. Moreover, many of these important sources of information including SGD, GeneDB, AGD, RGD and TAIR link back to GermOnline, increasing its visibility and impact. We are now in the process of soliciting researchers at a large scale. Please access http://www.germonline.org and retrieve information on many hundred genes as well as more than 10 array expression studies.
c) Textspresso
This is a new information retrieval and extraction system for Neurospora literature. Go to http://www.textpresso.org/nspora/
Tony Griffiths NPC Chair
Also at the 23rd Fungal Genetics Conference at Asilomar, Tom Hammond of the University of Wisconsin, Madison, received the Richard L. Weiss award for excellence in a student presentation. Tom has also just deposited his RNA silencing plasmid pTMH44.2 into the FGSC collection.
4/18/05
I spent the weekend at a Soccer tournament in Tulsa Oklahoma. If you have heard that Kansas is flat, you would be
astonished at how flat Tulsa Oklahoma is.
Geoff Robson wrote today and asked that I post a notice about the British Mycological Society Main 2005 meeting (Sept 5-8) to be held at Manchester University
4/15/05
There have been a number of requests for help sending packages internationally, including simple things like plasmids and Neurospora strains.
We recommend that you send international packages using FedEx because their customs brokers are very experienced.
The World Federation for Culture Collections has researched this issue and made specific recommendations.
We recommend that you not use the postal system. Most BSL level 1 and 2 organisms are not hazardous goods. For international shipments we always write
"non-pathogenic, non-infectious, not hazardous. For research only. No commercial or resale value" on the commercial invoice. We also describe the contents
in detail including genus and species. If you are concerned about shipping, deposit your material at the FGSC and let us handle these issues.
FGSC technician, Sheera Walker recently attended a FedEx dangerous goods seminar.
4/14/05
I read an interesting article from the January, 25 PNAS today.
It seems that the genome of a laboratory strain of yeast is free to accumulate higher levels of variability than a wild strain.
Even well cared for strains have controversy about their provenence. If you have a strain that has been passaged ten times in your laboratory, the likelyhood of its carrying mutations approaches certainty. At the FGSC we do not routinely passage strains. When you get a strain from us, you are getting the closest thing to the original generation that may be available.
We have 161 silica gel stocks and 250 lyophilized spore samples from 1960. 861 of our silica gel stocks were prepared before 1970. If you want to be sure that your strain is what you expect it to be, get a copy from the FGSC.
Veronica finished putting the links into the author index to the Neurospora Newsletter volumes 1-32.
4/13/05
Tax-day is fast approaching in the USA. It is hard to be critical, since we are supported largely by the US NSF.
We are enjoying a very busy winter at the FGSC with over 700 strains already distributed in 2005. Keep up the work. We are happy to send stuff out.
Next on our agenda is the knockouts from the Neurospora Functional Genomics Program.
Meanwhile, UMKC continues to stir things up. Last December, the
faculty ousted the Chancellor. Now there is an active search for a new Chancellor.
What this will all mean for Biological Sciences at UMKC remains to be seen.
4/11/05
We received four Ascobolus strains from Dr. George Bistis today. Two are A. stericorarius (FGSC 9915 and FGSC 9916) and two are A. furfuraceus
(FGSC 9917 and FGSC 9918).
We also received the plasmid pPK2 from Dr. Sarah Covert. This plasmid is for using Agrobacterium to transform fungi and is described in Mycological Research 105:259-264.
We are putting links into the Neurospora Newsletter indices. So far the co-author, subject, methods and mutants indices are all linked to the online articles.
4/10/05
Please visit the Perkins lab web-site. You will find great photos and
descriptions of the sexual biology of Neurospora.
Neurospora has been selected by the NIH as a model research organism. Please support this by visiting the NIH Neurospora web-site
After a busy meeting at Asilomar, we have made the updates we promised to the online abstracts and are getting back to normal. Please be aware that there was some concern about the number of abstracts for which posters were not presented.
March 2005
In time for the 23rd Fungal Genetics Conference, we have put the Aspergillus Newsletter online. The ANL was published
from 1960 - 1978.
| Return to the FGSC main page | About the FGSC Blog | Back to the FGSC Blog |