Secondary Metabolism and Pathogenicity Abstracts

Abstract numbers 197- 287


197. A viral infection upregulates fungal virulence in Nectria radicicola. Il Pyung Ahn. Seoul National University, Agricultural Biology, Suwon, Kyunggi, South Korea.

Four distinct sizes of double-stranded RNA (dsRNA) molecules, 6.0, 5.0, 2.5, and 1.5kbp, were detected from 24 out of 81 isolates of Nectria radicicola (anamorph: Cylindrocarpon destructans), the causal fungus of ginseng (Panax ginseng) root rot. They are present singly or in combinations. Curing tests of each dsRNA molecule suggested that the presence of 6.0kbp dsRNA is responsible for increased virulence, sporulation ability, laccase activity, and pigmentation in this fungus. To understand the role of this dsRNA molecule further, 6.0kbp dsRNA was reintroduced to cured isolates (dsRNA free) by hyphal anastomosis. Acquisition of this dsRNA molecule by dsRNA free isolates recovered all virulence-related phenotypes. Ultrastructural observation of mycelia by transmission electron microscope also supported the physiological changes by curing and reintroduction of this dsRNA molecule. These results are clear evidence that 6.0kbp dsRNA upregulates fungal virulence in N. radicicola by demonstrating the cause and effect relationship. To characterize this 6.0kbp dsRNA at molecular level, cDNA library was constructed. Sequencing of several cDNA clones revealed that this molecule harbors RNA-dependent RNA polymerase (RDRP) gene. Phylogenetic analysis of this gene to other RDRP genes indicated that this gene is closely related to those of plant cryptic viruses. Although this dsRNA molecule is believed to be the genome of fungal virus, all efforts to detect typical virus particles were failed. We are in progress to elucidate the biochemical mechanisms how 6.0kbp dsRNA upregulates fungal virulence in N. radicicola. Preliminary data suggested that this dsRNA molecule is involved in the regulation of cAMP-dependent protein kinase.

198. Characterization of ABC transporters from Aspergillus nidulans. Alan C. Andrade1, Johannes G.M. Van Nistelrooy1, Giovanni Del Sorbo2, Paul L. Skatrud3, and Maarten A. De Waard1. 1Wageningen Agricultural University, Lab. of Phytopathology, Wageningen, , The Netherlands. 2University of Naples, Patologia Vegetale, Portici, NA, Italy. 3 Eli Lilly and Company, Infectious Diseases, Indianapolis, IN, USA.

ATP-Binding Cassette (ABC) transporters constitute a large protein superfamily with members involved in multi-drug resistance (MDR) in a variety of organisms, ranging from bacteria to human. These proteins are transport ATPases which may have a wide range of substrates such as natural products (e.g.antibiotics or mating pheromones) or xenobiotics (e.g. drugs or fungicides). We use the saprophytic wild-type fungus Aspergillus nidulans and azole-resistant mutants to study the role of ABC transporters in fungicide sensitivity and MDR. Four single copy genes, designated atrA (ABC transporter A), atrB, atrC and atrD were cloned and characterised. The deduced proteins contain two groups of six transmembrane regions (TM6) and two nucleotide binding folds (NBF). The topology of AtrAp and AtrBp is (NBF-TM6)2 whereas that of AtrCp and AtrDp (TM6-NBF)2. By Northern analysis experiments, a number of compounds were identified that upregulate the expression of specific atr genes. We have also found a differential effect of these compounds on transcription of the atr genes among the isolates tested. Single knock-out mutants of all four atr genes have been generated and the drug-sensitivity phenotype to several chemicals analysed. For two of these mutants, delta atrB and delta atrD, a hypersensitive phenotype to some chemicals has been observed suggesting a role of these ABC proteins as drug tranporters. The characterization of the physiological function of the atrgenes is also of interest and a putative role in the secretion of secondary metabolites and fitness under stress-conditions is being investigated. The results indicate that ABC transporters can play an important role in protection of the fungus against naturally toxic compounds and xenobiotics. Current research focuses on the generation of overexpressing mutants and multiple knock-outs of atr genes.
Acknowledgements: CAPES-Brazil and Eli Lilly and Company-USA.
199. Sequences expressed primarily during filamentous growth in Ustilago maydis. David L. Andrews, Scott E. Gold. University of Georgia, Plant Pathology, Athens, Georgia, USA.

The corn smut pathogen (Ustilago maydis) exhibits dimorphism in that the haploid stage grows in a budding, yeast-like state while the dikaryon develops a filamentous morphology before/during pathogenic infection. The filamentous form of U. maydis requires an interaction with the maize host before the teliospore-containing galls are formed. This dimorphic transition has been associated with both the cyclic AMP pathway and the MAP kinase pathway. We have employed the technique of suppressive-subtractive hybridization to isolate sequences differentially expressed in the filamentous form of U. maydis. RNA for these experiments was isolated from a well-characterized, constitutively filamentous, haploid adenylate cyclase (uac1) mutant and from a wild-type budding haploid. This method has yielded greater than thirty clones which were more highly expressed in the target tissue. Of the clones identified so far, one was found to be the previously reported, filament specific, rep1 sequence. The characterization of other clones obtained by this method will be discussed.

200. Characterization of a low pathgenicity mutant of Botrytis cinerea.Anne Vidal-Cros1, Florence Chapeland2, Marie-Christine Soulié2 Martine Boccara2,3 .1Chimie Organique Biologique, 2Biochimie et Pathologie Végétales Université Pierre et marie Curie - 4, place Jussieu - 75252 PARIS CEDEX 05 - FRANCE. 3Pathologie Végétale INA P/G 16 rue Claude Bernard 75005 PARIS FRANCE

Botrytis cinerea is a pathogenic fungus which attacks a broad range of plants. It provokes grey mould on grapevine and is responsible of losses on several other crops. Fungicides are used to control this pathogen but become less effective because of fungicide resistance in fungal population. To develop new strategies against B cinerea it is important to decipher the pathogenicity mechanisms of this fungus. We first developed tools to approach molecularly the pathogenicity of B cinerea. B cinerea can be transformed (1) and Faretra et al. (2) showed that it is possible to cross strains in the laboratory. We have also observed, as others, that homologous recombination can occur at a frequency of 20% which is encouraging for gene disruption experiments. We are testing the role of cell wall biosynthesis, in pathogenicity with two approaches: on one hand, an a priori approach involving chitin synthase gene disruption (see poster of MC Soulie) and on the other hand, random mutagenesis using REMI method. Results and discussion We have isolated a mutant (G32) among a collection of transformants with the pAN7-1 plasmid (hygromycin resistance) which is poorly pathogenic on several hosts, like apple fruit or vine leaf. However, this mutant grows in vitro similarly to the wild type strain. In addition, G32 is resistant to calcofluor, a character that has been associated in the case of yeast with an impairment in chitin biosynthesis. G32 was found to synthesize as much chitin as the wild type strain and to exhibit the same chitin synthase activity. These results are consistent with the observation that the chitin synthase genes are not disrupted. Segregation analysis suggests that calcofluor resistance and low pathogenicity are cosegregating in G32. Analysis of culture filtrates of the mutant shows that it produces 5 times more oligosaccharides than the wild type strain, suggesting that the low pathogenicity phenotype is due to hyperproduction of plant defence reactions elicitors. These oligosaccharides are not chitooligomers, their further charcterization is in progress. Altogether, this piece of work describes a new type of calcofluor-resistant mutant.

201. Fungal recognition of legume flavonoids: potential action through inhibition of cAMP phosphodiesterase activity. Savita Bagga. University of Maryland, Cell Biol. & Molec. Genet, College Park, MD, USA.

Flavonoids are exuded by legume roots and seeds as a host-specific signal for initiating interaction with symbiotic rhizobial bacteria. Recent studies in a number of systems suggest that soilborne fungi which interact with legumes may similarly use the flavonoids as cues for host recognition. We have described germination of the macroconidia of pea pathogenic strains of Nectria haematococca MPVI (anamorph Fusarium solani) in response to specific flavonoids which induce nod genes in the pea-specific rhizobia. Germination is also induced by the pea isoflavonoid phytoalexin pisatin, which is similarly exuded from pea roots. Previous inhibitor studies indicated that flavonoid-responsive germination in N. haematococca involves the cAMP pathway. This is supported by an observed rise in cAMP levels upon exposure of spores to flavonoid. Common models of the cAMP pathway would suggest that the flavoinoids are recognized by a receptor. We present an alternate hypothesis, that flavonoids may increase cAMP levels by direct inhibition of cAMP phosphodiesterase activity. The cAMP phosphodiesterase (PDE) activity was isolated from N. haematococca spores. Naringenin, a flavanone which induces germination, displays very strong inhibition of PDE activity, with a Ki close to the KM of PDE for cAMP. A range of flavonoids were compared for germination stimulation and inhibition of PDE activity. The results indicate a general correlation of specificity. This suggests that inhibition of cAMP hosphodiesterase may be the molecular component of N. haematococca which provides flavone and flavanone recognition and integration into the cAMP pathway. The entry point for pisatin, an exception in the correlation, may be a different component.

202. Molecular basis of mitochondrial hypovirulence in a Cryphonectria parasitica strain obtained from nature. Dipnath Baidyaroy, David H. Huber, Dennis W. Fulbright and Helmut Bertrand1, Department of Botany and Plant Pathology and Department of 1Microbiology, Michigan State University, East Lansing, MI 48823.

Although dsRNA viruses often are hypovirulence agents in the chestnut blight fungus Cryphonectria parasitica, many hypovirulent strains contain no viruses but instead have dysfunctional mitochondria. KFC9 is one such strain which was isolated from a healing canker on a tree in Michigan. Analysis of the mitochondrial DNA (mtDNA) of KFC9 and its derivatives (virulent strains rendered hypovirulent by hyphal contact with KFC9) revealed that a particular region of the mtDNA of KFC9 is responsible for the infectious hypovirulence phenotype. That region of the mtDNA contains the small subunit rRNA gene with an inserted piece of DNA (InC9) located just 67-bp downstream of the beginning of the mature rRNA transcript. InC9 is 973-bp long, does not resemble introns or transposons, has no sizable open reading frame and does not have homology to any existing sequence. Molecular analyses have revealed that InC9 is either not spliced or spliced with great difficulty from the precursor rRNA. As a result, KFC9 is deficient in the assembly of mitochondrial ribosomes. The molecular basis of the infectious nature of InC9 is not clear at this time. The KFC9 strain was also found to contain an infectious 1366-bp long, circular, plasmid-like element (PLE), parts of which have been derived from the mtDNA. Loss of this PLE gives rise to a slightly faster-growing culture which remains hypovirulent. The observations indicate that InC9, rather than the PLE causes the infectious mitochondrial hypovirulence syndrome found in KFC9. Supported by USDA grant 95-37303-1785 and MAES Project No. MICL01662.

203. Analyses of pathogenicity by Mycosphaerella pathogens of bananas.Peter J. Balint-Kurti1, Mi Jin2, Alice C. L. Churchilll, Jon C. Clardy2, Gregory D. May1. 1Boyce Thompson Institute for Plant Research, Molecular Mycology Center, Ithaca, NY, USA. 2Cornell University, Chemistry/Chem. Biology, Ithaca, NY, USA.

A genetic transformation system was developed for three related fungal pathogens of banana, Mycosphaerella fijiensis and M. musicola, causal agents of Black Sigatoka and Yellow Sigatoka disease, respectively, and the newly discovered pathogen M. eumusae (J. Carlier, personal communication). Stable transformants expressing green fluorescent protein were isolated from all three species, and growth on susceptible hosts was examined. Growth both on the surface and within leaves was observed. Leaf penetration was exclusively via stomata. Profuse necrotrophic growth was observed in dead leaf tissue. Evidence for the production of both a diffusible toxin and a self-inhibitor of conidiospore germination was noted. Growth of transformants on the non-host plants tomato, tobacco, and Arabidopsis was also characterized. Extracts were prepared from mycelium and culture fluids of the Mycosphaerella pathogens and screened for plant toxicity. Several fractions from M. musicola exhibited non-specific phytotoxicity, and in some cases the toxicity was light-activated, as revealed by a banana cell culture-based assay. Preliminary results suggest that M. musicola, which produces an anthraquinone-derived photoactivated toxin, is more resistant to singlet oxygen-generating photosensitizers than is M. fijiensis, which does not produce the toxin in detectable amounts.

204. Analysis of pathogenicity and genome organization in Ophiostoma ulmi and O. novo-ulmi. Louis Bernier1, Clive M. Brasier2, Josee Dufour1, Mathieu Dusabenyagasani1, and Abdelali Et-Touil1. 1Universite Laval, C.R.B.F., Sainte-Foy, Quebec, Canada. 2Forest Research, Alice Holt Lodge, Farnham, Surrey, U.K.

Ophiostoma ulmi and O. novo-ulmi are the heterothallic ascomycetes responsible for the two highly destructive pandemics of Dutch elm disease that have occurred in this century. We are developing a genetic map of these pathogens by mendelian analysis of RAPD polymorphisms in the F1 progeny from a O. novo-ulmi x O. ulmi cross. Close to 150 RAPD loci have so far been mapped on 10 linkage groups. Pulsed-field gel electrophoresis has allowed us to detect chromosome polymorphisms in O. ulmi and O. novo-ulmi and to physically separate 7-8 chromosomes depending on the strain analyzed. Field inoculations of moderately resistant English elms with F1 progeny of a cross between two O. novo-ulmi strains differing in pathogenicity established that the difference in phenotype between these strains was controlled by a single nuclear locus. We have designated this locus Pat1, as it is the first putative pathogenicity gene identified in O. novo-ulmi. Southern hybridizations with probes prepared from RAPD markers linked to Pat1 showed that Pat1 was located on a 3.5 Mb chromosome. Furthermore, our results suggest that the Pat1-m allele conferring lower pathogenicity may have been acquired from O. ulmi via introgression.

205. Avirulence genes cloning in the rice blast fungus Magnaporthe grisea.Heidi Bohnert1, Waly Dioh2, Didier Tharreau 3, Jean-Loup Notteghem4, and Marc-Henri Lebrun1. 1UMR41 CNRS-RPA, Physioloige Cellulaire, Lyon, 69009, France. 2Universite Paris-Sud, IGM, Orsay, 91405, France. 3CIRAD, CA, Montpellier, 34032, France. 4 ENSAM, Pathologie Végétale, Montpellier, 34032, France.

Genetic studies with M. grisea isolates pathogenic on rice and fertile in crosses revealed three genetically independent avirulence genes [1] that are likely to interact with so far undescribed rice resistance genes. We initiated the positional cloning of these three genes using RAPD markers screened by bulk segregant analysis and RFLP markers. Two avirulence genes mapped near chromosome ends (avr1-MedNoï and avr1-Ku86). The avirulence gene avr1-Irat7 mapped on chromosome one at 30 cM from avr1Co39. We identified 11 RAPD markers closely linked to these avirulence genes (0-10 cM). Most RAPD markers corresponded to junction fragments between M. grisea genome and known transposons [2]. Positional cloning was started by the screening of a cosmid genomic library from an avirulent progeny by hybridisation with single copy sequence RAPD markers. For RAPD markers containing repeated sequence, we performed a RAPD analysis on cosmid pools and clones [3]. Cosmids contigs were constructed for these three loci. Starting from RAPD marker OPE-Y13 completly linked to avr1-Irat7, we constructed a contig of 100 kb. Two cosmids from this contig conferred avirulence on rice cultivar Irat7 when introduced by transformation in a virulent recipient strain, defining a 30 kb region where avr1-Irat7 is located. Up to now, we have not found a smallest subclone from this region able to complement virulence. The two other contigs are in the process of extension towards avirulence genes. 1. Silue D. et al. 1992. Phytopathology 82: 1462-1467. 2. Dioh W. et al. 1996. In Rice Genetics 3, IRRI, pp. 916-920. 3. Dioh W. et al. 1997. Nucleic Acid Research 25: 5130-5131

206. Transfer of Neurospora kalilo plasmids among species and strains by introgressions. Jin-Woo Bok, Cynthia He, and Anthony J.F. Griffiths. University of British Columbia, Department of Botany, Vancouver, BC, Canada.

There are four different variants of the kalilo "family" of linear mitochondrial plasmids. The family is found in several heterothallic species and one pseudohomothallic species of Neurospora, and in one homothallic species of Gelasinospora. The mode of dispersal of these plasmids is not known. Horizontal transmission has proved difficult to demonstrate. Another possibility is transfer by introgression, and this is modelled in this paper. We have used introgression and subsequent heterokaryosis to successfully transfer the prototypic kalilo plasmid from a Haitian strain of N. crassa to the standard Oak Ridge N. crassa background, the LA-kalilo plasmid from the pseudohomothallic N. tetrasperma to N. crassa, and the kalilo plasmid from N. crassa to N. tetrasperma. Thus introgression is a possible avenue of dispersal between species. The recipient strains were all senescent but the mechanism of this senescence is not known. It could be caused by the plasmids, but if so the mechanism is novel since plasmid/mtDNA junction fragments of the type found in the standard mode of mtDNA insertion could not be detected. However, mtDNA changes are observed in the senescent recipients.

207. Identification of a polyketide synthase gene (pksP) of Aspergillus fumigatus involved in conidial pigment biosynthesis and virulence. Axel A. Brakhage1, Kim Langfelder 1, Axel Schmidt2, Gerhard Wanner3, Heike Gehringer1, Sucharit Bhakdi 4, and Bernhard Jahn 4. 1Institut für Mikrobiologie und Genetik, Technische Universität Darmstadt, D-64287 Darmstadt, F.R.G.; 2Institut für Chemotherapie, D-42096 Wuppertal, F.R.G.; 3Botanisches Institut, Universität München, D-80338 München, F.R.G.; 4Institut für Medizinische Mikrobiologie, Universität Mainz, D-55101 Mainz, F.R.G. .

Aspergillus fumigatus is an important pathogen of the immunocompromised host, causing pneumonia and invasive disseminated disease. We have tried to identify factors which contribute to conidial survival in the host, which is essential for causing disease. An A. fumigatus mutant strain ("white", W), lacking conidial pigmentation, was isolated by UV-mutagenesis. Scanning-EM revealed the surface morphology to be different from that of the wild type (WT). Luminol-dependent chemiluminescence was ten-fold higher when human neutrophils or monocytes were challenged with W conidia, compared to WT conidia. In addition, W conidia were more efficiently damaged by monocytes in vitro and they were more sensitive to attack by oxidants in vitro. In a murine mouse model the W mutants exhibited reduced virulence. A genomic cosmid library was used to clone a gene complementing the W phenotype. Because it encodes a putative polyketide synthase, it was designated pksP (polyketide synthase involved in pigment biosynthesis). The W mutant complemented with pksP displayed all the WT characteristics, indicating that the conidial pigment is of major importance for virulence.

208. Propionate metabolism of Aspergillus nidulans: Characterization of the methylcitrate synthase. Matthias Brock1, Reinhard Fischer2, and Wolfgang Buckel1. 1Philipps-Universität Marburg, Microbiology, Marburg, Hessen, Germany. 2Max-Planck Institute, Biochemistry, Marburg, Hessen, Germany.

Propionate is used as a preservative against molds in food, grain-silage and cell cultures. Aspergillus nidulans, as a model organism for eucaryotic research, is able to grow on propionate as sole carbon and energy source. A. nidulans metabolises propionate via the methylcitrate pathway which was discovered in Candida lipolytica and more recently in Escherichia coli. The methylcitrate synthase as a key enzyme of this pathway was purified and biochemically characterized. The protein was shown to consist of two identical subunits (45 kDa each). The methylcitrate synthase can use both propionyl-CoA or acetyl-CoA for the condensing reaction with oxaloacetate to form methylcitrate or citrate, respectively. A DNA probe was derived from the N-terminal sequence. A genomic cosmidbank was screened and a corresponding 3.2 kb restriction fragment was sequenced. By analysing the reverse transcribed cDNA sequence two introns were found. The derived amino acid sequence showed more than 50% identity to most eucaryotic citrate synthases and revealed a mitochondrial import leaderpeptide. The mcs gene was fused with the alcA promotor of A. nidulans and overexpressed in the same organism. The overproduced protein was purified and showed the same activity as the original methylcitrate synthase. A deletion mutant of the mcs gene was constructed. The mutant did not show any residual growth on propionate as sole carbon and energy source, proving that the methylcitrate pathway is crucial for propionate metabolism in A. nidulans.

209. Withdrawn

210. Complementation of an Aspergillus nidulans mutant defective in aflR expression. Robert A.E. Butchko1, Thomas H. Adams2, and Nancy P. Keller1. 1Texas A&M; University, Plant Pathology and Microbiology, College Station, TX, USA. 2Texas A&M; University, Biology, College Station, TX, USA.

aflR encodes a conserved pathway specific transcription factor that regulates the expression of gene clusters involved in the biosynthesis of aflatoxin by Aspergillus flavus and A. parasiticus and sterigmatocystin (ST) by A. nidulans. We have already shown that aflR expression is developmentally regulated in A. nidulans, mutants that fail to conidiate are also defective in aflR expression. In an effort to more fully understand the regulation of the production of ST by A. nidulans, we have identified A. nidulans mutants that no longer express aflR transcript but retain wild type development. These mutants were easily identified by looking for strains that no longer accumulated the orange colored intermediate in the ST pathway, norsolorinic acid (NOR). One of the mutant strains contained a single locus mutation unlinked to the ST cluster. Transformation of this strain with a wildtype cosmid library returned the strain to NOR production and also restored the production of the green conidia. This preliminary data suggests that the gene responsible for regulating aflR expression is linked to wA. Here we describe the complementation and characterization of one of these mutants.

211. Genetic, morphological and biochemical investigations of a "cryptic species" within Aspergillus flavus. Dee A. Carter1, and John I. Pitt2. 1University of Sydney, Microbiology, Sydney, New South Wales, Australia. 2Food Science Australia, Food Mycology, Sydney, New South Wales, Australia.

Independent studies undertaken by Geiser et al (PNAS 95:399-393, 1998) using DNA sequencing, and Tran-Dinh et al (in press) using RAPD analysis, found that isolates of Aspergillus flavus from Australian peanut-growing soils divided into two very distinct groups. In both studies the two groups were uneven, with the larger group (Group 1) containing approximately 70% and 60% of isolates, respectively. A. oryzae isolates also fell into this group, and both groups were distinct from A. parasiticus. The current study was undertaken to investigate the difference between these two groups, and to analyse isolates belonging to the smaller group (Group 2) more thoroughly. Morphological, biochemical and genetic tests were able to clearly separate the two groups. Group 1 appears to be the "standard" A. flavus, with a ubiquitous distribution, but Group 2 seems restricted in distribution and may represent a new species of Aspergillus.

212. The influence of surface characteristics on contact-mediated spore germination in Colletotrichum graminicola. Jennifer L. Chaky and Lisa J. Vaillancourt. University of Kentucky, Plant Pathology, Lexington, KY, USA.

Spore germination is an essential step in the disease cycle of most fungal pathogens, yet little is known of the molecular mechanisms regulating this process. Conidia of Colletotrichum graminicola can easily be produced in culture, and they germinate efficiently (between 90 and 98%) within five hours when placed in drops of plain, sterile water on a hard, hydrophobic surface. Spore germination was measured on a variety of surfaces using this bioassay. A strong positive correlation was observed between germination rate and surface hydrophobicity (r = 0.938). Spores which remained ungerminated in the assays were arrested at a point after spore hydration but prior to septation. The hypothesis that stronger adhesion of the spores to more hydrophobic surfaces is related to the increase in germination on those surfaces is presently being tested. Various dilute salts in the water drops inhibited germination of spores on otherwise inductive surfaces, perhaps by disrupting the adhesive interactions between the spore and the surface. Several mutants with altered germination phenotypes in the bioassay have been identified, and characterization of these mutants is underway in an effort to learn more about the mechanism of contact-mediated spore germination in C. graminicola.

213. The development of DNA-mediated transformation of Erysiphe graminis f.sp. hordei. Pushpalata T. Chaure, Sarah J. Gurr and Pietro Spanu. University of Oxford, Plant Sciences, Oxford, Oxford, UK.

The barley powdery mildew fungus, Erysiphe graminis f.sp. hordei is the obligate biotroph which is responsible for the most consistently damaging foliar disease of barley. The role in pathogenicity of stage-specific genes and the identification of avirulence genes requires functional validation by modulation or ablation of the respective genes. For this reason there is a need to develop technologies for the stable genetic transformation of Erysiphe. We have used two selectable markers, a mutant beta-tubulin gene and a BAR gene to attempt stable DNA-mediated transformation of E. graminis. Mutations E 198 A and F 200 Y in E. graminis beta-tubulin result in benomyl resistance. The introduction of this mutated beta-tubulin confers resistance to benomyl in Erysiphe. Rare stable transformants have been identified. The Streptomyces BAR gene was cloned downstream of the beta-tubulin promoter and this construct was used to transform E. graminis in planta, to confer resistance to the herbicide BASTA. The data from these studies will be presented.

214. Molecular cloning and biochemical analysis of two genes for HC-toxin biosynthesis in Cochliobolus carbonum. Yi-Qiang Cheng and Joong-Hoon Ahn. Michigan State University, DOE Plant Research Lab, East Lansing, MI , USA.

HC-toxin, a cyclic tetrapeptide produced non-ribosomally by Cochliobolus carbonum race 1, is the disease determinant of Northern corn leaf spot. It is also cytostatic against mammalian cells by inhibiting histone deacetylase. A major goal of research in our lab is to clone and characterize all of the necessary genes for toxin biosynthesis and transport. So far four genes have been identified. HTS1 encodes a 570-kDa tetrapartite cyclic peptide synthetase; TOXA encodes an efflux carrier; TOXC, a fatty acid synthase (FAS) beta subunit; and TOXE, a regulatory protein. All these genes are present only in toxin-producing isolates (Tox2+) of C. carbonum, and map to a single 3.5-Mb chromosome within a ca. 550 Kb region (called the Tox2 locus). Here we present the cloning of two new clustered genes (TOXF and TOXG) with possible roles in HC-toxin biosynthesis. They were cloned by screening a cDNA library with a BAC clone that covers part of the Tox2 locus. Both of them are unique to Tox2+ isolates of C. carbonum. TOXF is predicted to encode a branched-chain amino acid aminotransferase (BCAT); TOXG likely encodes an alanine racemase (AR). Targeted gene-disruption/deletion of TOXF or TOXG abolished the ability to produce HC-toxin and pathogenicity on susceptible maize lines. Both BCAT and AR are being overexpressed in E. coli, and the biochemical reactions catalyzed by the two proteins will be investigated.

215. The chestnut pathogen Cryphonectria parasitica exhibits resistance to singlet oxygen-generating photosensitizers. Alice C. L. Churchill. Boyce Thompson Institute for Plant Research, Molecular Mycology Center, Ithaca, NY, USA.

The orange and yellow aromatic polyketide pigments of Cryphonectria parasitica comprise 5-10% of the dry weight of the fungus and, as such, represent a significant proportion of its biomass. A review of the literature indicates that these anthraquinone-derived pigments exhibit antimicrobial and antiviral activities, as well as causing induction of apoptosis, DNA damage, and inhibition of signal transduction pathway enzymes in mammalian cells. Quinones represent the largest class of redox cycling compounds and have the potential to be highly toxic through the formation of oxygen radicals. Many species of Cercospora, which produce the photoactivated perylenequinone toxin cercosporin, are resistant to photosensitizers that generate singlet oxygen. The gross similarities in chemical structure between cercosporin and the C. parasitica pigments prompted us to test the chestnut pathogen for resistance to photoactivated dyes that produce singlet oxygen. We have demonstrated that wild type C. parasitica is resistant to several singlet oxygen-generating photosensitizers, whereas an albino mutant is significantly more susceptible to the same light-activated compounds. These results suggest that C. parasitica has an active defense mechanism against singlet oxygen-generating compounds, perhaps linked to its own production of similar molecules. We are interested in determining whether the C. parasitica pigments are involved in the production of toxic reactive oxygen species. Ultimately, our goal is to understand whether the pigments play roles in pathogenicity and/or chemical defense in the tritrophic interactions among the chestnut tree, its fungal pathogen, and the Hypoviruses that suppress both fungal virulence and pigment production.

216. Cloning of pathogenicity genes by insertional mutagenesis in Magnaporthe grisea.Pierre-Henri Clergeot1, Didier Tharreau 2, Jean-Loup Notteghem 3, Stephanie Sibuet 4, Marie-Pascale Latorse 5, and Marc Henri Lebrun1. 1UMR41 CNRS-RPA, Physiologie Cellulaire, Lyon, 69009, France. 2CIRAD, CA, Montpellier, 34032, France. 3ENSAM, Pathologie Végétale, Montpellier, 34032, France. 4Rhone-Poulenc Agro, Biotechnologies, Lyon, 69009, France. 5Rhone-Poulenc Agro, Fongicides, Lyon, 69009, France.

Unraveling functions implicated in the infection process of plant pathogenic fungi is an important challenge for crop protection in the future. We are searching for pathogenicity genes of the rice blast fungus Magnaporthe grisea using a REMI-based plasmid insertional mutagenesis strategy (1). We analyzed 3000 REMI transformants for their pathogenicity defects by individual spore inoculation on detached rice and barley leaves as a preliminary screen. Their defect in pathogenicity was confirmed by inoculation on rice plants. We recoverd around 25 mutants either non-pathogenic (8) or significantly reduced in their pathogenicity (17). Among ten mutants crossed with a compatible wild type strain, three (M421, M700 and M763) were tagged by one copy of the plasmid. The mutant M700 corresponded to an insertion of the plasmid in the melanine pathway gene buf1. The number of lesions caused by mutant M763 was dramatically reduced compared to wild type (-95%). The non-pathogenic mutant M421 (no lesions) was able to differentiate appressoria with a reduced osmotic pressure. (2) that did not penetrate through the cuticle. Flanking regions to the plasmid were cloned by inverse-PCR for M421 and by plasmid rescue for M763. Two cosmids hybridizing with the M421 flanking region were identified from which a genomic subclone of 3,5 kb complemented the mutation. Cloning and sequencing of its cDNA highlighted a 0,67 kb ORF interrupted two short introns. The 225 aa protein deduced from this ORF is likely to be a new small membrane protein involved in appressorium function. (1) Sweigard et al. (1998), Mol. Plant Micr. Interact., 5: 404-412. (2) de Jong et al. (1997), Nature, 389: 244-245.

217. Supernumerary chromosomes in filamentous fungi. Sarah F. Covert. University of Georgia, Forest Resources, Athens, GA, USA.

Several fungal genomes are known to contain supernumerary chromosomes. These chromosomes are composed primarily of DNA that is present in only a subset of the individuals within a given species, and thus they contain genetic information that is not essential for life. Both the structural and functional characteristics of supernumerary chromosomes make them interesting components of fungal genomes. The structural features of some supernumerary chromosomes suggest that they evolved in a different genetic background than the essential chromosomes in the same genome. Functional genes on the supernumerary chromosomes in at least two species contribute to the disease causing capacity of the isolates that contain them. If a complete understanding of fungal genome structure, function and evolution is to be attained, it will be essential to include analysis of the supernumerary elements within fungal genomes.

218. Development of an efficient system for insertional mutagenesis of Penicillium chrysogenum. Katarzyna Czechowska and Ulrich Kück. Ruhr-Universität Bochum, Allgemeine Botanik, Bochum, NRW, Germany.

The filamentous fungus Penicillium chrysogenum is of great industrial importance as major producer of penicillin. To elucidate the penicillin biosynthesis in more detail, the identification of genes controlling antibiotic production is essential. One way to identify these regulatory genes is the isolation of mutants affected in penicillin biosynthesis. In order to obtain this type of mutants for genetic analysis we intend to tag genes by insertion of foreign DNA. Here we present the development of an efficient system, known as restriction enzyme-mediated integration (REMI) [1], for insertional mutagenesis of P. chrysogenum. We analysed the transformation efficiency in the presence and absence of restriction enzymes during transformation. An increase of transformation efficiency was found up to 9-fold in the presence of the restriction enzyme during transformation and the efficiency varies with the amount of the enzyme used. The mode of plasmid integration was determined by Southern analysis of randomly chosen transformants. Perfect REMI events occur in more than 65 % of the analysed transformants and in more than 35 % of the transformants we found a single integration event. Finally we succeeded in isolating vector flanking sequences from individual transformants by plasmid rescue. Further experiments will be aimed to identify the function of those genes, which are disrupted by the plasmid molecule. [1] Schiestl RH, Petes TD (1991) Proc Natl Acad Sci USA 88: 7585-7589

219. Evidence for a new mating population of Fusarium subglutinans from teosinte and maize from Mexico and Central America. Anne E. Desjardins1, Ronald D. Plattner1 and Thomas R. Gordon2. 1USDA/ARS, NCUAR, Peoria, IL, USA. 2University of California, Davis, CA, USA.

Seed samples from maize (Zea mays ssp. mays) from Mexico and of teosintes (Zea spp.), the nearest wild relatives of maize, from Mexico and Central America were assessed for infection with Fusarium species. Both maize and four teosinte species were infected with strains similar in morphology to F. subglutinans and more than half of the strains were sexually intercompatible. None, however, were sexually compatible with standard testers of Gibberella fujikuroi mating populations B and E, which are the teleomorphs associated with F. subglutinans from Graminae worldwide. These data indicate that these strains from Mexico and Central America may comprise a distinct mating population. A female fertile strain from teosinte was also sexually compatible with a strain of F. subglutinans that causes pitch canker disease of pines in California, indicating that strains of F. subglutinans from teosinte and maize have a close relationship to G. fujikuroi mating population H, to which the pine strain has been assigned.

220. The role of ras and Galpha homologs in PTH11-mediated signaling in Magnaporthe grisea. Todd M. DeZwaan, Anne M. Carroll and James A. Sweigard. Dupont, Experimental Station, Wilmington, DE, USA.

PTH11 encodes a novel membrane protein that is required for pathogenicity by the blast fungus Magnaporthe grisea. Pth11p appears to be involved in signal perception that leads to infection structure formation. Since PTH11 has no obvious homologs, we searched for parallels in which an atypical receptor transduces an intracellular signal. Like Pth11p, the MEP2 ammonium permease of budding yeast appears to function as an atypical receptor. Whereas Pth11p appears to initiate infection structure differentiation in response to cues on the host leaf surface, Mep2p appears to initiate yeast pseudohyphal differentiation in response to ammonium starvation. The defects of M. grisea pth11 strains and S. cerevisiae mep2 strains are both suppressed by exogenous activation of intracellular signaling with cAMP. Based on these similarities we hypothesize that the function of Pth11p during pathogenesis may be analogous to that of Mep2p during yeast nutrient signaling. To test this we are examining genetic interactions between PTH11 and homologs of yeast signaling components that function during pseudohyphal differentiation. Specifically, mep2 mutations are complemented by constitutively active alleles of a ras protein homolog and a G-protein alpha subunit homolog. We have identified and cloned two M. grisea ras homologs (RAS1 and RAS2) and a Galpha subunit homolog that was previously implicated in pathogenesis (MAGB). We are currently examining whether RAS1 and RAS2 are required for pathogenesis and plan to explore the relationship of the RAS genes and MAGB to PTH11 by constructing constitutively active and dominant negative alleles of these small G-proteins, and expressing them in wild type and pth11 mutant cells.

221. The PTH11 gene encodes a novel upstream component of pathogenicity signaling in the rice blast fungus Magnaporthe grisea. Todd M. DeZwaan, Anne M. Carroll, Barbara Valent, and James A. Sweigard. Dupont, Experimental Station, Wilmington, DE, USA.

The blast fungus Magnaporthe grisea forms appressoria in response to specific cues on the host leaf surface. Multiple intracellular signaling components have been identified that mediate appressorium differentiation and function but none of these are thought to act at the cell surface. Thus, it is unclear how extracellular cues are transduced into a pathogenicity-specific signaling cascade. Through insertional mutagenesis we have identified the PTH11 gene encoding a novel protein with multiple membrane spanning domains. pth11 mutants fail to produce significant disease and are impaired in their ability to form appressoria. However, pth11 mutants grow invasively, conidiate in planta, and exhibit wild type vegetative growth and sexual differentiation. pth11 mutants of three distinct M. grisea strains show a similar pathogenicity defect and the PTH11 gene is functionally conserved in distantly related M. grisea haplotypes. To determine whether PTH11 plays a signaling role in pathogenesis we examined the effects of exogenous cyclic AMP and diacylglycerol. Cyclic AMP suppressed the pth11 appressorium defect and restored wild type levels of disease whereas diacylglycerol only suppressed the appressorium defect. These findings suggest that PTH11 plays an upstream role in pathogenicity signaling, possibly by acting at the cell membrane to respond to host surface cues.

222. The role of calcineurin in dimorphism and pathogenicity in the corn smut pathogen Ustilago maydis. John W. Duick and Scott E. Gold. University of Georgia, Plant Pathology, Athens, GA, USA.Ustilago maydis is a dimorphic basidiomycete and is the causal agent of corn smut disease. It exists as a budding saprophyte in the haploid stage and as an obligate filamentous parasitic dikaryon when two compatible haploid cells fuse. The dikaryon ramifies within the tissue of maize plants eventually causing the formation of galls containing the sooty zygotic teliospores, from which the name smut originates. Dimorphism in U. maydis is controlled through signal transduction pathways involving cAMP and the mitogen-activated protein (MAP) kinase cascade. Protein phosphatases have the role of reversing the effects of protein kinase phosphorylation. Post translational modification and specifically protein phosphorylation is a ubiquitous form of regulation in signal transduction pathways. Calcineurin (also referred to as protein phosphatase 2B or PP2B) is a serine/threonine protein phosphatase and, in other systems, has a role in reversing the phosphorylation of the substrates of cAMP dependent protein kinase A. Through a reverse genetic approach, degenerate primers based on the calcineurin catalytic subunit were used to clone a 795 base pair putative calcineurin fragment. Screening of a cosmid library by sib selection led to the recovery of the full-length cosmid clone UMPP2B. Characterization of the calcineurin gene and progress toward an understanding of its role in dimorphism and pathogenicity in U. maydis will be discussed.

223. Identification of a gene pacC homologue from the dermatophyte Trichophyton rubrum. Monica Stropa Ferreira1, Walter Maccheroni Jr.2, Sérgio Ricardo Nozawa 3, Antonio Rossi 3, and Nilce Maria Martinez-Rossi 4. 1University of Sao Paulo, Genetica, Ribeirao Preto, Sao Paulo, Brazil. 2University of Sao Paulo, Genetica/ ESALQ, Piracicaba, Sao Paulo, Brazil. 3Quimica, Ribeirao Preto, Sao Paulo, Brazil. 4Genetica, Ribeirao Preto, Sao Paulo, Brazil.

T. rubrum is a filamentous fungus whose capability to invade human keratinized tissue (skin, hair and nails) to produce infections is probably related to the secretion of enzymes. Thus, because enzyme secretion may also be influenced by ambient pH, this physiological response could be determinant for the virulence of dermatophytes. Based on regions of homology found between the PacC protein sequences of A. nidulans, A. niger and P. chrysogenum, degenerate oligonucleotides were designed and used to amplify genomic fragments from T. rubrum by PCR. A search with the deduced amino acid sequence of a 219 bp amplification product showed high similarity to the A. nidulans and other PacC proteins, which are responsible for the general control of ambient pH response. Furthermore, the complementation of the pacC14 mutant of A. nidulans was achieved by co-transformation of the pAB4-ARp1 plasmid (a fungal autonomously replicating vector) with total genomic T. rubrum DNA, with the recovery of most of the extracellular acid phosphatase isoforms of a transformant being observed by isoelectric focusing (IEF). On the other hand, the physiological role of the pacC homologue in T. rubrum pathogenicity remains to be clarified.

224. Organization and variation of subtelomeric regions of the rice blast fungus Magnaporthe grisea. Weimin Gao and Seogchan Kang. Pennsylvania State University, Plant Pathology, University Park, PA 16802, USA.

Management of rice blast through breeding of blast-resistant cultivars has had only limited success due to the frequent breakdown of resistance under field conditions. Considering the mainly clonal population structure of rice blast fungus Magnaporthe grisea in many rice-growing areas, frequent appearance of new pathotypes with the ability to infect previously resistant rice cultivars suggests a high degree of genetic variation. The main objective of this work is to elucidate the nature and mechanisms of genetic changes at the chromosome ends of M grisea. Two telomeres of O-137, a rice pathogen isolate, were cloned and characterized. One of them, Tel-2, contains a gene, designated as TLR-1, encoding a protein of 744 amino acids that shows significant similarity to RecQ helicases from various organisms and to yeast SGS1</>. The TLR-1 gene was used as a probe for RFLP mapping. The sequence homologous to this probe was present from nine to eleven copies and segregated with at least six different telomeres, suggesting that many telomeric regions of the mapping parents have sequences homologous to the TLR-1 gene. Flanking regions of TLR-1 were also amplified in telomeric regions. Eighteen field isolates from various hosts were screened with TLR-1 as a probe. Most isolates from grass species other than rice did not contain the gene, but all rice pathogens had multiple copies of the gene. This result supports the idea that rice pathogens are genetically isolated from isolates from other hosts. We will report how TLR-1 and its flanking sequences are organized in rice pathogens.

225. AOS-scavenging enzymes in the phytopathogen Claviceps purpurea.Victoriano Garre, Sabine Moore, Klaus B. Tenberge, and Paul Tudzynski. Westf. Wilhelms-Universitaet, Institut für Botanik, Muenster, Germany.

Claviceps purpurea, a (hemi-) biotrophic pathogen of cereals, infects and colonizes young ovaries, and taps the vascular tissue located at the base of the ovary. There, a stable host-pathogen interface is established. During colonization the fungus is confronted with species of active oxygen (AOS), which are generated in the course of normal ontogenetic processes and during defense reactions (e.g. lignification). We are interested in the ability of fungus to overcome this oxidative stress and in the importance of such mechanisms for pathogenicity. We have started the characterization of AOS-scavenging enzymes in C. purpurea, which involves the cloning of the corresponding genes, the study of their expression in planta and the analysis of deletion mutants. In planta, the fungus secretes at least three catalases (1), and one SOD. We have cloned one SOD and two catalase genes so far. One of the catalase genes (cpcat1) encodes two extracellular catalases (CAT C/D); deletion of this gene has no effect on pathogenicity (2). Expression studies and functional analysis of the other genes is in progress. (1) Garre V, Tenberge KB, Eising R: Phytopathol. 88, 744-753 (1998). (2) Garre V, Müller, U, Tudzynski P: MPMI. 11, 772-783 (1998). Present address of the first author: Dpto. Genetica y Microbiologia, Facultad de Biologia, Universidad de Murcia. Apdo.4021, 30071 Murcia, Spain

226. The ubc3 gene of Ustilago maydis encodes a MAP kinase that is required for filamentous growth. Scott E. Gold, Maria E. Mayorga, and David L. Andrews. University of Georgia, Plant Pathology, Athens, Georgia, USA.

Ustilago maydis, the causal agent of corn smut disease, displays dimorphic growth in which it alternates between a budding haploid saprophyte and a filamentous dikaryotic pathogen. Previously we identified a role for the cAMP signal transduction pathway in the dimorphic switch of this fungus. Haploid strains mutant in the uac1 gene encoding adenylate cyclase display a constitutively filamentous phenotype. Mutagenesis of the uac1 disruption strain allowed the isolation of a large number of budding suppressor mutants. These mutants are named ubc, for Ustilago bypass of cyclase as they no longer require the production of cAMP to grow in the budding morphology. Analysis of one of these suppressor mutants led to the identification of ubc3 (Mayorga and Gold, 1998), which is required for filamentous growth and encodes a MAP kinase most similar to those of the yeast pheromone response pathway. This is the third member of this putative MAP kinase cascade along with ubc4 (MAPKK kinase) and ubc2 (see Mayorga and Gold abstract) that we have identified. Mutations in the earlier identified fuz7 MAPK kinase (Banuett and Herskowitz, 1994) also suppress the filamentous phenotype of the uac1 disruption mutant providing additional corroborating evidence that fuz7 is likely a member of this same MAP kinase cascade. We describe the role of the ubc3 gene in mating and in pathogenicity.

227. A homologue of a gene implicated in the virulence of human fungal diseases is present in a plant fungal pathogen and expressed during infection. Neil Hall, John P.R. Keon, and John A. Hargreaves. IACR Long Ashton, Cell Biology, Long Ashton, Bristol, UK.

The gene encoding SnodProt1 (SP1), an extracellular protein secreted by the wheat fungal pathogen, Stagonospora (Septoria) nodorum, has been isolated and characterised. The deduced amino acid sequence exhibited significant similarity to antigenic and allergenic proteins encoded by genes cloned from the human fungal pathogens, Coccidioides immitis and Aspergillus fumigatus, respectively. SP1 also exhibited similarity to an EST cDNA derived from the rice blast fungus, Magnaporthe grisea, grown on isolated rice cell walls. Northern and western blot analyses showed that the gene encoding SP1 is expressed and that the protein is secreted during infection of wheat leaves.

228. An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease. John E. Hamer, Martin Urban, and Tishina Bhargava. Purdue University, Biological Sciences, West Lafayette, IN, USA.

Cells tolerate exposure to cytotoxic compounds through the action of ATP-driven efflux pumps belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. Phytopathogenic fungi encounter toxic environments during plant invasion as a result of the plant defense response. Here we demonstrate the requirement for an ABC transporter during host infection by the fungal plant pathogen Magnaporthe grisea. The ABC1 gene was identified in an insertional mutagenesis screen for pathogenicity mutants. The ABC1 insertional mutant and a constructed deletion mutant are dramatically reduced in pathogenicity towards various hosts but show no discernible defects in vitro. ABC1 is most similar to yeast ABC transporters, Pdr5 and Cdr1, implicated in multidrug resistance. Consistently, expression of the ABC1 gene is inducible by toxic drugs including a rice phytoalexin. The insertional mutation in ABC1 appears to disrupt the regulatory element required for induction by metabolic poisons. These data strongly suggest that fungal pathogens require ABC transporters to protect themselves against plant defense mechanisms.

229. Genome wide mutagenesis and sequencing for filamentous fungi. Lisbeth Hamer, Amy Page, Jeff Woessner, Matt Tanzer, Kiichi Adachi, Scott Uknes, and John E. Hamer. Paradigm Genetics, Fungal Research, RTP, NC, USA.

Genome wide mutagenesis and gene function analysis is facile in baker's yeast due to the availability of the entire genomic sequence, and the low level of ectopic recombination during DNA-mediated transformation. Typically, PCR fragments with just ~40 bp of target sequence flanking an appropriate marker are sufficient to direct an insertion into a specific target in the yeast genome. None of the above advantages are available in filamentous fungi; complete genome sequences for filamentous fungi are lacking and targeted recombination requires larger flanking DNA fragments (> 1-2 kb), which makes construction of gene knockout vectors a laborious task. Finally, the low level of homologous recombination means that knockouts must be identified against a background of ectopic recombination events. The Fungal Research Group at Paradigm Genetics is committed to develop a high through-put gene function discovery process for filamentous fungi and to inventory and resource this information to discover new antifungal chemicals and fungal derived products. We have developed an assembly line process that combines genome sequencing and knockout vector construction. This technology also permits multiple rounds of mutagenesis to be performed on target sequences facilitating construction of leaky and conditional alleles. We are currently applying this technology to the rice blast fungus, with the goal of elucidating the function of numerous uncharacterized genes.

230. Isolation of the avirulence gene AVR2-MARA of Magnaporthe grisea. Travis M. Harper, and Marc J. Orbach. University of Arizona, Plant Pathology, Tucson, Arizona, USA.

Genetic analysis of cultivar specificity in the rice blast fungus, Magnaporthe grisea, has identified a second gene, AVR2-MARA, that confers avirulence toward the rice cultivar Maratelli. A series of crosses demonstrated that AVR2-MARA, which originated in strain 4091-5-8, segregates independently from AVR1-MARA. Through RFLP analysis, AVR2-MARA was mapped to Chromosome 7, between the 2 markers, cos196 and cos209. A chromosome walk from the cos209 marker, which is 7 recombination crossover points (rcps) from AVR2-MARA, was initiated. Because M. grisea strains demonstrate a high degree of synteny, the walk was started using a BAC library of strain 4224-7-8, which does not contain AVR2-MARA. The first two steps of the walk crossed 4 and 2 rcps, respectively. The physical distance of these two steps is ~50 kb and ~80 kb respectively, leaving the walk 1 rcp from the AVR2-MARA locus. Progress during the walk has been hampered by the high degree of repetitive DNA, making BAC end clones generally ineffective for walk progression. Repetitive elements have been identified by hybridization to BAC clones. In conjunction with the BAC library, a cosmid library of strain 4091-5-8 is being probed to cross the remaining rcp. In addition to the efforts to clone AVR2-MARA, attempts to isolate virulent mutants of the gene will also be reported.

231. Repetitive DNA elements as genetic markers in Chondrostereum purpureum. William E. Hintz, Elisa Becker, Paul de la Bastide, and Louise Hahn. University of Victoria, Biology, Victoria, BC, Canada.

Productivity in conifer reforestation sites is reduced by competition by fast-growing hardwood species. The phytopathogenic fungus Chondrostereum purpureum is well suited to forest vegetation management as it has a broad-spectrum pathogenicity towards many hardwoods and prevents resprouting of cut trees. While C. purpureum occurs naturally throughout North America, little is known about its population structure. We therefore developed a series of molecular markers to (1) identify specific isolates and (2) assess the impact of release of selected isolates. Amplification of C. purpureum genomic DNA with the RAPD primer GGGGTGACGA resulted in the amplification of 3 to 12 fragments certain of which were conserved at the population level. We determined the DNA sequence of a unique RAPD fragment from the lead isolate and designed a SCAR primer pair (GGGGTGACGAGGACGACGGTG and GGGGTGACGACATTATACTGCAGGTAGTAG). It was anticipated that this primer pair would amplify a single DNA fragment from the lead isolate however several fragments, ranging in size from 300 bp to 2000 bp, were simultaneously amplified from genomic DNA of all C. purpureum isolates tested. The SCAR amplification patterns have proven to be distinctive for each genetic individual tested making this a particularly useful fingerprinting tool. Sequence comparison of the amplified SCAR DNAs revealed extensive DNA similarity between fragments and we hypothesize that these DNAs represent members of a family of dispersed repetitive DNA elements.

232. Cloning and disruption of protein kinase genes in Aspergillus nidulans. Louise M. Hoare1, A. Renwick 2, A. Dickson1, and G.D. Robson1. Manchester University, School of Biol.Sci., Manchester, UK. 2Zeneca Agrochemicals, Jealotts Hill, Bracknell, Berkshire,UK.

Novel antifungal agents are constantly required due to the build up of disease resistance in fungal pathogens and the toxic effects of existing agents. Targets must be identified in the pathogens which when disrupted have a debilitating effect on the fungi, inhibiting their ability to infect the host and cause disease. Map kinases have been found to be involved in hypo-osmolarity signal transduction and cell wall integrity in Saccharomyces cerevisiae and may therefore be putative antifungal targets. Using Aspergillus nidulans as a model, we have designed PCR primers based on consensus to the PKC protein kinase family. As a second strategy, osmotically sensitive mutants are being produced by UV mutagenesis which only grow on osmotically buffered medium. The long term strategy is to clone the full length genes and to study the effect of knockouts on the phenotype of A. nidulans.

233. Homologs of aflatoxin biosynthetic genes in Aspergillus oryzae and A. sojae. David Jeenes, Adrian Watson, Linda Fuller, and David Archer. Institute of Food Research, Norwich Research Park, Norwich UK.

Although aflatoxin biosynthesis has been documented for Aspergillus flavus and A. parasiticus, the closely related species A. oryzae and A. sojae which are widely used in food and ingredient manufacture have no history of producing aflatoxins. Despite this lack of aflatoxin production, several groups have reported the presence of genes associated with aflatoxin biosynthesis, including the pathway-specific regulatory gene aflR, in strains of A. oryzae and A. sojae. We confirm by sequencing the presence of 3 structural genes (nor-1, ver-1 and omtA) and the regulatory gene, aflR, in strains of A. oryzae and A. sojae. We also report the sequence of the entire aflR gene from A. oryzae ATCC 14895. Northern blot and RT-PCR analysis show that none of these genes are actively transcribed in the chosen strains of A. sojae/A. oryzae. Sequence analysis reveals that the AFLR proteins are truncated by ca. 60 aa in all the A. sojae strains examined, a mutation that appears to be linked to a small duplication at the N-terminal end of the protein.

234. Loss of a dispensable chromosome from Alternaria alternata apple pathotype leads to a toxin minus phenotype and loss of pathogenicity. L.J. Johnson1, R.D. Johnson1, H. Akamatsu2, M. Kodama1, H. Otani2 and K. Kohmoto1. 1Faculty of Agriculture, Tottori University, Tottori 680, Japan, 2United Graduate School of Agricultural Sciences, Tottori University, Tottori 680, Japan.

We have cloned a cyclic peptide synthetase gene, AMT, from Alternaria alternata apple pathotype that catalyses the production of AM-toxin, a host-specific toxin responsible for pathogenicity. Pulsed-field gel electrophoresis (PFGE) and Southern analysis showed that the gene is located on a small chromosome 1.7Mb or smaller depending on the strain. Expression of AMT was investigated by RT-PCR using pathogenic and non-pathogenic isolates, including AM-toxin minus mutants. AM-toxin production was determined by a leaf necrosis bioassay on susceptible and resistant apple cultivars and expression of AMT was correlated with AM-toxin production. In addition a laboratory sub-cultured strain previously shown to produce AM-toxin was negative by RT-PCR and a leaf necrosis bioassay confirmed a toxin minus phenotype. However, an original isolate of this strain which had not undergone sub-culture gave a positive result by both RT-PCR and bioassay. CHEF analysis and Southern hybridisation demonstrated the loss of a 1.1 Mb chromosome in the non-toxin producing isolate. Both isolates have identical colony morphologies and RAPD profiles indicate that they share common origins. This indicates that the 1.1 Mb chromosome is non-essential for normal growth but necessary for pathogenicity.Supported by a research grant from the Ministry of Education, Science and Culture of Japan.

235. Cloning of a cyclic peptide synthetase gene whose product catalyses the production of AM-Toxin responsible for pathogenicity of Alternaria alternata apple pathotype. R. D. Johnson1, L. J. Johnson1, Y. Itoh3, M. Kodama1, H. Otani2, J. D. Walton4 and K. Kohmoto1. 1Faculty of Agriculture, Tottori University, Tottori 680, Japan, 2United Graduate School of Agricultural Sciences, Tottori University, Tottori 680, Japan, 3Faculty of Science, Shinshu University, Matsumoto 390, Japan, 4Department of Energy Plant Research Laboratory, Michigan State University, MI48824, USA.

Alternaria alternata apple pathotype causes Alternaria blotch of susceptible apple cultivars through the production of a cyclic peptide host specific toxin, AM-toxin. PCR, using primers designed to conserved domains of cyclic peptide synthetase (CPS) genes, amplified several products from A. alternata apple pathotype whose deduced amino acid sequence showed high similarity to other fungal CPSs and were specific to the apple pathotype. Screening of a Lambda Zap genomic library with these PCR generated probes identified overlapping clones containing a complete CPS gene, designated AM-toxin synthetase gene (AMT), of 14kb in length with no introns. RT-PCR on toxin minus mutants generated by REMI demonstrated that expression of this gene was eliminated. To confirm that AM-toxin synthetase is the primary determinant of virulence and specificity in the A. alternata apple pathotype/apple interaction, disruption of AMT by transformation of wildtype A. alternata apple pathotype with disruption/replacement vectors based on the plasmid pAN7-1 is being carried out.Supported by a research grant from the Ministry of Education, Science and Culture of Japan.

236. A genetic map using AFLP markers of Fusarium moniliforme (Gibberella fujikuroi, MP-A). James E. Jurgenson1, K. A. Zeller2, and J. F. Leslie2. 1University of Northern Iowa, Biology, Cedar Falls, IA, USA. 2 Kansas State University, Plant Pthology, Manhattan, KS, USA.

Fusarium moniliforme (Gibberella fujikuroi, MP-A) is primarily a pathogen of maize, but can also cause disease in other crop species. This pathogenicity, as well as mycotoxin production, causes billions of dollars of economic losses annually. We have continued to develop F. moniliforme as a model genetic system for understanding these plant pathogenic fungi. However, the dissection of important biological characteristics in this fungus has been hampered by the lack of a uniformly dense genetic map. The existing RFLP-based map contains significant gaps, making it more difficult to locate biologically important genes, such as those involved in mycotoxin production, with precision. We have utilized AFLPs (Amplified Fragment Length Polymorphisms) to supplement the genetic map. We have added more than 500 AFLP markers to the ~150 markers in the existing map. The resulting map has an average marker interval of 5 map units, and averages only 10-11 kb / map unit. This map has a length of >3500 map units divided into the 12 linkage groups described previously. There are no holes in the map greater than 25 map units. We have identified AFLP markers at only 2 map units from the mating type locus, and from the spore killer (Sk) locus. Another AFLP marker maps only 6 units from the fum1 (fumonisin biosynthetic) locus. The increased saturation of this map will facilitate further development of F. moniliforme as a model system for the genetics and population genetics of these plant pathogenic fungi.

237. Isolation of genes related to the appressorium formation from a differential library of Magnaporthe grisea. Takashi Kamakura1, Kenichiro Saitoh2, Tohru Teraoka2, and Isamu Yamaguchi1. 1RIKEN Institute, Microbial Toxicology Lab., Wako, Saitama, Japan. 2Tokyo Univ. Agric. Tech., Agruculture, Fucyu, Tokyo, Japan.

The conidial germ tube of Magnaporthe grisea differentiates a specific infection structure, an appressorium, for penetration into the host. Formation of appressorium was observed not only on rice leaves but also on synthetic solid substara such as polycarbonate. We found that a plant lectin, concanavalin A, specifically suppressed the appressorium formation without affecting the germling adhesion if it was applied within 2-3 hours after germination. From the result, we have constructed a cDNA library which represents the appressorium differentiation stage from the 2.5 hours-old germ tubes. For the construction of the library, a double-subtractive cDNA cloning strategy was taken to condense the differential cDNAs expressed during early stage of the development of conidial germ tube and/or appressorium formation. Out of 686 colonies of the library, about 150 distinct clones' nucleotide sequence were determined partially. A melanine biosynthesis gene (BUF1) was found in the library and this strongly suggests that the library contains genes expressed during appressorium forming stage. We have further analyzed some of candidates which showed differential expression by RT-PCR analysis. Gene disruption of one unknown gene, clone A4, caused remarkable change of appressorium differentiation on the artificial solid substrates but not on the plant surface. This gene was expressed specifically in the young germling and we could not detect any transcripts in the vegetative growth mycelia by RT-PCR. The structure and presumable function of the gene will be discussed.

238. Dissection of nonhost resistance of Nicotiana to Phytophthora infestans using a Potato Virus X vector. Sophien Kamoun1, Shujing Dong1, Edgar Huitema1, Vivianne G.A.A. Vleeshouwers2, Francine Govers2. 1The Ohio State University-OARDC, Plant Pathology, Wooster, OH, USA. 2Wageningen Agric. Univ., Phytopathology, Wageningen, The Netherlands.

Specific recognition events, defined by the perception of pathogen elicitors by plant receptors, trigger defense responses including the hypersensitive response (HR), a form of programmed cell death in plants. Phytophthora infestans, the causal agent of late blight of potato and tomato, produces INF elicitins, a diverse family of extracellular proteins that induce the HR in a restricted number of plants, particularly in the genus Nicotiana within the Solanaceae. Resistance of Nicotiana to P. infestans is always associated with a rapid HR of epidermal and mesophyll cells, which restricts the pathogen to the infection site. Our studies aim at determining whether this response is mediated by the recognition of elicitins. P. infestans strains deficient in the major elicitin INF1 induced disease lesions on Nicotiana benthamiana, suggesting that INF1 functions as an avirulence factor that conditions resistance in this species (S. Kamoun, P. van West, V. Vleeshouwers, K. de Groot, and F. Govers, 1998, Plant Cell, 10:1413). In contrast, INF1 deficient strains remained unable to infect other Nicotiana species, such as tobacco. Tobacco may therefore respond to additional elicitors, perhaps other members of the complex INF elicitin family. To dissect the response of Nicotiana to elicitins, functional expression of inf genes in plants was conducted using a recombinant Potato Virus X (PVX) vector. These PVX-inf constructs triggered a number of responses such as local and systemic HR lesions, allowing a quantitative evaluation of the response of Nicotiana to the various INF elicitins. This study shows that species-specific elicitors can be used to dissect nonhost resistance into discrete components.

239. Establishment of differentially expressed gene profile from hypovirulent strain of Cryphonectria parasitica . Hyun-Seok Kang, Moon-Sik Yang, and Dae-Hyuk Kim. Chonbuk National University, Biological Sciences, Chonju, Chonbuk, South Korea.

Ordered differential display which has advantages of high sensitivity, reproducibility, proportional representation, and limited number of primer combinations has been conducted to have a profile on the differently expressed genes between a hypovirulent strain of Cryphonectria parasitica (UEP1) as well as its isogenic wild type (EP155/2). RNAs were prepared from 1 and 5 days after the liquid culture of both strains and they were further verified with the known marker genes of C. parasitica such as laccase, cryparin, and MF2-1. Expressed genes were categorized to five groups according to their temporal expression patterns and those fives groups are CPC, CPE, CPL, CPD, and CPU which indicate constitutive, early-expressed, late-expressed, down-regulated, and up-regulated, respectively. Those genes belong to five groups were amplified, cloned and sequenced. Characterization of 50 clones were conducted and more are under investigation.

240. Expression of an active cytokine from the recombinant Aspergillus niger. Myoung-Ju Kim, Tae-Ho Kwon, Yong-Suk Jang, Moon-Sik Yang, and Dae-Hyuk Kim. Chonbuk National University, Biological Sciences, Chonju, Chonbuk, South Korea.

Aspergillus niger has been developed as a host organism for the production of foreign protein and becomes an attractive candidate for large-scale production of heterologous proteins. Granulocyte-macrophage colony stimulating factor(GM-CSF), along with G-CSF, is one of the first hematopoietic regulators to be deployed clinically, and is now used widely to ameliorate chemotherapy-induced neutropenia and to enhance hematopoietic recovery after bone-marrow transplantation. Thus we made an effort to express and secrete an active murine GM-CSF(mGM-CSF) from the recombinant A. niger. Five hundred bp fragment encoding mGM-CSF was cloned inbetween promoter and terminator of glyceraldehyde 3-phosphate dehydrogenase (gpd) and hygromycin phosphotransferase gene (hph) was used as a selection marker. The expression vector was introduced into A. niger ATCC 2119 and Northern blot analysis indicated a considerable expression of the introduced mGM-CSF. The biological activity of recombinant mGM-CSF from the culture filtrate was confirmed by measuring the proliferation of the GM-CSF dependent FDC-P1 cell line. The productivity estimated by ELISA was increased up to 640 ng/L of mGM-CSF and its specific activity was further increased more than three-times than that of commercial preparation.

241. Isolation of Fusarium moniliforme mutants with reduced fusaric acid production. Gretchen A. Kuldau, James K. Porter, Emma Wray, Rita Bennet, Anthony E. Glenn, Charles W. Bacon. USDA-ARS, TMRU, Athens, GA, USA.

Fusarium moniliforme (Gibberella fujikuroi) is an agronomically important ascomycete that synthesizes mycotoxins such as fumonisins and fusaric acid during both asymptomatic and symptomatic associations with its primary host, maize. Fusaric acid is produced in moderate to high levels by all isolates of F. moniliforme and by many other Fusarium species. It is considered a phytotoxin, but its role in potentiating asymptomatic and symptomatic infection of maize is largely unexplored. We have found that in vitro production of fusaric acid is stimulated in low iron conditions and repressed in conditions of iron abundance. Modification of a thin layer chromatography (TLC) method has allowed us to detect fusaric acid production directly from agar plugs containing fungus. Using the low iron medium and TLC method for screening we have isolated two F. moniliforme UV-induced mutants with low and very low fusaric acid production. Confirmation and quantitation of fusaric acid production by the mutants was accomplished using GC/MS analysis. We are currently performing genetic crosses to determine if the production phenotypes observed are due to single gene mutations. The UV mutants will be used to study the role of fusaric acid in interactions between F. moniliforme and maize.

242. Investigation of hgl1, a gene involved in cAMP-dependent morphogenesis in the corn smut Ustilago maydis. R. David Laidlaw1, Franz Durrenberger2, and James W. Kronstad1. 1University of British Columbia, Biotechnology, Vancouver, B.C., Canada. 2Discovery Technologies , Innovation Center, Allschwil, Switzerland.

During sexual and pathogenic development, Ustilago maydis undergoes a morphological switch from a yeast-like budding growth morphology to a branched filamentous morphology. Control of the phenotypic switch is known to be regulated by both a pheromone response pathway and a cAMP-dependent protein kinase A (PKA) pathway. The morphological switch in U. maydis involves a gene named adr1, which encodes a catalytic subunit of PKA that is responsible for the majority of PKA activity (1). adr1- cells display a constitutively filamentous phenotype; in contrast, cells with elevated PKA activity are budding. A novel gene (hgl1) was identified through complementation of a yeast-like adr1- suppressor mutant back to the filamentous adr1 morphology. Efforts are now underway to further examine the role of the hgl1 gene in morphogenesis and pathogenicity. hgl1- cells display a variety of phenotypes, including an interesting defect for teliospore formation during completion of the sexual life cycle in the host plant. PSI-BLAST and Blocks searches using the hgl1 sequence have not identified any significant homologs to suggest a function for Hgl1. Here, we present results investigating the regulation of hgl1 transcription in both haploid and diploid U. maydis strains, as well as data gathered utilizing in vitro expressed proteins to address the possibility of Hgl1 phosphorylation by Adr1. The preliminary characterization of mutants which suppress the yeast-like cell morphology of both hgl1- and adr1-hgl1- mutant strains will also be presented. 1) Dürrenberger et al. (1998) Proc. Natl. Acad. Sci. USA 95, 5684-5689

243. Characterization of the chromosome that contains ToxA of Pyrenophora tritici-repentis and its homolog from a non-pathogenic wheat isolate. Amnon Lichter1, Ganey M. Gaventa2, and Lynda Ciuffetti2. 1The Volcani Center, Dep. of Postharvest Sci., Bet Dagan, Israel. 2Oregon State University, Botany & Plant Pathology, Corvallis, OR, USA.

The protein encoded by ToxA of Pyrenophora tritici-repentis is a unique host-specific toxin. Once introduced into a non-pathogenic wheat isolate of P. tritici-repentis the ToxA gene was shown to transform it to a pathogenic fungus. Comparative karyotype analysis was conducted to determine the chromosomal localization of ToxA and to determine if a cognate chromosome is present in a non-pathogenic Pyrenophora strain. Major karyotype polymorphisms between pathogenic and non-pathogenic isolates, and to a lesser extent among pathogenic strains, made it impossible to assign homologous chromosomes based on size. ToxA was localized to a 2.85Mb chromosome and PCR-based subtraction was carried out with the ToxA chromosome used as tester DNA and genomic DNA from a non-pathogenic isolate, as driver DNA. Seven of 8 single copy probes that originated from the 2.85Mb chromosome could be assigned to a 2.75Mb chromosome of the non-pathogenic strain while one probe was unique to the pathogen. Six of the probes revealed identical restriction patterns in comparative analysis of the pair of pathogenic and non-pathogenic strains, while 2 probes identified restriction-length polymorphisms. Extension of this analysis to several other isolates with selected probes revealed identical as well as polymorphic patterns. Nine different repetitive DNA probes originated from the 2.85Mb chromosome including sequences that correspond to known fungal transposable elements, but none were confined to it. Interestingly, they were either present at low copy number or absent from the non-pathogens and displayed polymorphic patterns among the isolates. In conclusion, a homolog to the chromosome containing ToxA is present in non-pathogenic P. tritici-repentis, although karyotype and repetitive DNA analyses indicate it is distinct from pathogenic P. tritici-repentis

244. Genetics of Laccase of Gaeumannomyces graminis. Anastasia P. Litvintseva, Kathy B. Sheehan, and Joan M. Henson. Montana State University, Microbiology, Bozeman, MT, USA.

Six genes coding for the multi-copper phenol oxidase, laccase, were isolated from the ascomycete G. graminis. Three genes were subcloned from a genomic library of G. graminis var. graminis and the others were from a genomic library of G. graminis var. tritici. All six laccase genes and their predicted polypeptide sequences were typical of fungal laccases with conserved copper binding sites. Only two of the predicted polypeptides shared high amino acid homology (about 95%) with each other and other predicted gene products were significantly different. Promoters of three of these genes were sequenced. All of them contained putative Metal Responsive Elements (MRE), CreA-like and Nit-2-like protein binding sites and two of them had Xenobiotic Responsive Elements (XRE). One also contained an Antioxidant Responsive Element (ARE). The presence of these putative regulatory elements suggests that different environmental cues are involved in the regulation of expression of different laccase genes. This expression was studied by competitive RT-PCR. So far we have observed that at least two of the genes are constitutively expressed at low levels in the fungus, when it grows in Luria- Bertani (LB) broth, and their expression is induced by the presence of 400 mM Cu2+ and/or 40 mM xyladine.

245. A gene cluster from the corn pathogen Cochliobolus heterostrophus required for nonribosomal peptide biosynthesis and general virulence of fungi. S. W. Lu, B. G. Turgeon, and O. C. Yoder. Cornell University, Plant Pathology, Ithaca, NY, USA.

The gene CPS1 from the corn pathogen Cochliobolus heterostrophus encodes a putative multifunctional peptide synthetase. Two overlapping cosmid clones covering 33.7 kb of genomic DNA were isolated. Sequence analyses revealed, in addition to CPS1, at least 13 ORFs, nine of which had no apparent homologs in the database. Translation of each of the remaining four ORFs revealed significant similarity to a known protein, i.e., a thioesterase (TES1; 1.1 kb), a DNA-binding protein with a zinc cluster motif, a leucine zipper domain and a phosphorylation site for cAMP-dependent protein kinase (DBZ1; 1.8 kb), a coenzyme A transferase (COT1; 1.9 kb), and a decarboxylase (DEC2; 1.7 kb); partial sequencing of ORF15 suggests a transport protein. Comparison of genes in the CPS1 cluster with those in known peptide synthetase gene clusters shows substantial similarity, supporting the hypothesis that the CPS1 cluster is responsible for biosynthesis of a nonribosomal peptide (as yet unidentified). Homologs of CPS1 were found in other Cochliobolus spp. and in other fungal genera. Disruption of either CPS1 or DBZ1 caused drastically reduced virulence in each of three different pathogens, both races (O and T) of C. heterostrophus, C. victoriae (a pathogen of oats). Since race T and C. victoriae each requires a known host-specific toxin (the polyketide T-toxin and the cyclic peptide victorin, respectively) for virulence to host plants, the results suggest that the hypothetical CPS1-controlled peptide is a general virulence factor in pathogenic fungi, perhaps required to facilitate action of other virulence factors such as host-specific toxins.

246. Mapping of the Avr1a avirulence gene in Phytophthora sojae. Terry MacGregor 1, Madan Bhattacharyya2, and Mark Gijzen. 1University of Western Ontario, Plant Sciences, London, Ontario, Canada. 2Noble Foundation, Ardmore, Oklahoma, USA. 3Agriculture Canada, London, Ontario, Canada.

The Avr1a locus was mapped in two F2 populations derived from four different parental isolates. A combination of RAPD analysis and bulked segregant analysis resulted in the identification of five linked markers. Although these markers were linked to Avr1a in both populations, the arrangement of the markers around Avr1a was different for the two crosses. In one case the markers cover an 11 cM span and map to one side of Avr1a, while the second cross produced a map that spans 53 cM with markers on either side of Avr1a. Southern blots of the four parental strains were probed with the RAPD markers to determine any differences in RFLP patterns. In most cases, the RFLP pattern was consistent for each pair of virulence phenotypes. Taken together, these results suggest that the Avr1a genomic region is similar but not identical in the two avirulent parental isolates. To identify more markers and to produce a high density linkage map around Avr1a, we resorted to AFLP analysis. Many new markers were successfully identified and mapped. Most of the DNA markers, both RAPD and AFLP, appear as single copy sequences when cloned and used as probes in Southern blots. Thus, we are now ready to begin the physical mapping of Avr1a.

247. The ubc2 gene, a putative member of the MAP kinase cascade, is required for gall formation but not for cell fusion in the pathogenic fungus Ustilago maydis. Maria Elena Mayorga, and Scott E. Gold. University of Georgia, Plant Pathology, Athens, GA, USA.

Ustilago maydis, the causal agent of corn smut disease, displays dimorphic growth in which it alternates between a haploid unicellular, non-pathogenic yeast-like form and a dikaryotic, pathogenic filamentous form. We have identified a role for the cAMP signal transduction pathway in the dimorphic switch of this fungus. Earlier, a constitutively filamentous haploid mutant was obtained. Complementation of this mutant led to the isolation of the gene encoding adenylate cyclase, uac1. Secondary mutagenesis of a uac1 disruption strain allowed the isolation of a large number of suppressor mutants, termed ubc, for Ustilago bypass of cyclase, lacking the filamentous phenotype. Analysis of one of these suppressor mutants led to the identification of ubc2, which is required for filamentous growth and appears to encode a protein capable of interacting with other proteins. We describe the possible roles of ubc2 and its probable physical interaction with ubc4, a MAPKK kinase of U. maydis. An interaction between ubc2 and ubc4 suggests ubc2 functions in the pheromone responsive MAP kinase cascade. ubc2 is important not only for dimorphic switching but also in pathogenicity: ubc2 mutant dikaryons are capable of colonizing maize but are unable to induce gall formation. In cytoduction assays we show that fusion of two compatible ubc2 mutants occurs at a similar frequency as compatible wild type strains. Therefore, the inability to produce galls in planta is probably a post cell fusion defect caused by the ubc2 mutation.

248. Detoxification of avenacosides by Stagonospora avenae. John Morrissey, Jos Wubben, and Anne Osbourn. Sainsbury Laboratory, Norwich, UK.

The steroidal saponins, 26-desglucoavenacosides A and B, are present in oat leaves and may play a role in protecting the plant against fungal attack. The toxicity of 26-desglucoavenacosides towards fungi is dependent on the presence of a branched sugar side chain at the C3 position of the steroidal backbone. Characterisation of a collection of Stagonospora isolates revealed that isolates of the oat-attacking species S. avenae f. sp. avenae secreted an enzyme activity which was capable of detoxifying avenacosides by the sequential hydrolysis of L-rhamnose and D-glucose residues from the sugar chain whereas non-oat-attacking isolates did not. A beta-glucosidase which hydrolyses D-glucose residues from the side-chain was purified and the cognate gene cloned. This enzyme is related to saponin-detoxifying enzymes from two other phytopathogenic fungi, Septoria lycopersici and Gaeumannomyces graminis. Mutants generated by targeted disruption of the beta-glucosidase gene in one isolate of S. avenae retained the ability to hydrolyse the desglucoavenacoside sugar chain and were unaffected in pathogenicity. These data show that more than one enzyme is involved in the hydrolysis of these saponins and work is progress to characterise the other enzymes involved and to determine their role in the pathogenicity of S. avenae to oats.

249. Cloning and functional characterisation of ornithine decarboxylase in Tapesia yallundae. E Mueller1,2, A Bailey1, A Corran2, and P Bowyer1. 1Plant Molecular Pathology, IACR Long Ashton Research Station, University of Bristol, Long Ashton, Bristol BS41 9AF, UK; 2Zeneca Agrochemical, Jeallots Hill, Berks., UK.

Ornithine decarboxylase (ODC), is a key enzyme in the polyamine biosynthetic pathway. Polyamines such as spermidine and spermine are present in high amounts in differentiating cells such as germinating spores and sporulating mycelia and are essential for these processes. Plants use an alternative pathway for polyamine biosynthesis via arginine decarboxylase (ADC) whereas fungi soley use the ODC pathway. Polyamine biosynthesis (and in particular ODCase) is thus a good target for developing new fungicidal chemicals because plants should not be affected by ODC inhibitors. In order to evaluate ODC as a possible fungicide target, we set out to clone ODC from Tapesia yallundae (eyespot) and generate mutants by gene disruption. The mutants subsequently would be evaluated for their virulence. The ODC gene of Tapesia yallundae was isolated by PCR amplification. Primers were designed against conserved motifs in the central part of the gene. The PCR product was cloned and sequenced to confirm its identity and was subsequently used to screen a genomic library. The gene has been completely sequenced and a line-up of the deduced protein sequence showed high homology to those from other fungi. The coding sequence of the native ODC gene was replaced with the hygromycin resistance cassette and that construct was used to transform T. yallundae. Hygromycin resistance transformants were selected for putrescine dependant growth. Of 250 transformants screened, 7 were auxotrophic for putrescine. Southern analysis confirmed that the coding sequence in those mutants was deleted. The functionality of the T. yallundae ODC gene was confirmed by complementing mutants in A. nidulans and in T. yallundae. Both mutants are now able to grow in the absence of polyamines and the ability to produce spores was completely restored. Preliminary pathogenicity studies on the T. yallundae ODC mutants showed that the virulence of those mutants is possibly slightly reduced. Further detailed analysis is in progress.

250. LINE retrotransposon caused conidium morphogenetic mutation in Magnaporthe grisea. Marie Nishimura1, Nagao Hayashi2, Num-Soo Jwa1, John E. Hamer3, and Akira Hasebe1. 1Nat Inst of Agrobiological Res, Genetic Diversity , Tsukuba, Ibaraki, Japan. 2Nat Agri Res Center, Rice Desease, Tsukuba, Ibaraki, Japan. 3Purdue University, Biological Sciences, West Lafayette, Indiana, USA.

The rice blast fungus, Magnaporthe grisea, produces a cluster of conidia in sympodial array. We obtained three morphological mutants of M. grisea, designated CAC (CAtenated Conidia), by crossing two wild type rice-pathogenic strains. In CAC mutants, conidiogenesis pattern was altered that conidia were blasted from former produced conidia and catenated in chain, while, the branching pattern of conidiophore did not altered. Compared to the parental strains, 12 % of CAC mutants could form appressoria, in number, but they required extra 24 hours. CAC mutants lessened pathogenicity towards rice by 90%. Genetic segregation test suggested that the mutation was caused by one gene locus. By southern hybridization and sequencing analysis, it was appeared that MGL, a M. grisea LINE transposon, inserted in Acr1 gene in all CAC mutants. MGL duplicated 19 nucleotide-target sequences. These results indicated that active MGL caused morphological mutation and pathogenicity reduction in M. grisea.

251. Molecular characterization of a putative aryl-alcohol dehydrogenase from Botrytis cinerea. Hannah Noel1, Neil Hall2, Alexander Schouten3, John A. Lucas2, and Paul M. Wood1. 1University of Bristol, Biochemistry, Bristol, Avon, UK. 2IACR- Long Ashton, Cell Biology, Bristol, N. Somerset, UK. 3Wageningen University, Phytopathology, Wageningen, Netherlands

Botrytis cinerea (grey mould) is a ubiquitous pathogenic fungus causing pre-and post-harvest disease in many crops. The pathogen secretes a variety of extracellular enzymes including -galactosidases, pectinases and cellulases. However, there is no evidence for a direct phytotoxic effect of these enzymes in Botrytis, and the exact mechanisms of infection and induction of host cell death by the fungus are still obscure. Recent research has linked production of oxidative species (H2O2 and OH) during infection with the virulence of the fungus. We are investigating the possible involvement of aryl-alcohol dehydrogenases in the production of oxidative species. A sequence alignment of aryl-alcohol dehydrogenase genes, from other fungi was used as a source of degenerate primers. A 390 bp fragment of Botrytis cinerea genomic DNA was amplified by PCR using these primers. This fragment has been sequenced and found to have close similarity with the other aryl-alcohol dehydrogenases. It was then used to probe a genomic library, in order to retrieve the full-length sequence. Northern blot analyses of this transcript are now underway.

252. Transformants of Phialophora gregata for easy detection and visualization in soybeans.Teruo Nonomura, and Charlotte R. Bronson. Iowa State University, Plant Pathology, Ames, Iowa, USA.

Pathogenesis by Phialophora gregata, the causal agent of brown stem rot of soybeans, has been difficult to study cytologically because of its small, colorless conidia and hyphae. The fungus also grows slowly on media and is difficult to distinguish from other fungi that commonly inhabit soybean roots and stems. To facilitate observations of this fungus in planta, we transformed it with genes for green fluorescent protein (GFP), beta-glucuronidase (GUS), and hygromycin resistance (hygB). Transformants showing high levels of expression of the genes were tested for fitness by measuring colony diameter, dry mass and conidiation on media, and virulence in soybeans, compared to the non-transformed strain. Three of the transformants expressing GFP and hygB were indistinguishable from the non-transformed strain by all criteria. All tested transformants expressing GUS, however, were severely compromised in conidiation on media. Transformants expressing GFP and hygB will therefore likely be the most useful for studies of pathogenesis. Preliminary studies indicate that visualization of the fluorescent transformants in planta is reliable, although still challenging due to the small size of the fungus. However, spread of the fungus in planta is easily monitored by plating pieces of infected soybean tissue on hygromycin containing media. We are now using these transformants to determine how, where and when the fungus enters and moves within soybeans.

253. Genes induced in Fusarium graminearum/Zea mays interactions. Therese Ouellet, Audrey Saparno, Anju Koul, Sharon Allard, and Linda Harris. Agriculture and Agri-Food Canada, ECORC, Ottawa, Ont, Canada.

Fusarium graminearum attacks a wide range of plant species including maize (ear and stalk rot), barley, and wheat (head blight). Favorable environmental conditions (conducive temperatures and high humidity) can result in Fusarium epidemics and millions of dollars lost in crop revenues. F. graminearum infection in the cereals reduces both grain yield and quality. The grain is also contaminated with mycotoxins such as the trichothecenes. We have initiated a study of the molecular interactions between F. graminearum and maize during infection of the silk channel and ear in susceptible and resistant inbreds. Differential RNA display- RT-PCR has been used to identify genes, from F. graminearum and maize, that are elicited in the early stages of infection of maize silk by the fungus. Additionally, infection in resistant inbreds has been compared to that from highly susceptible inbreds using this technique. Unique cDNA fragments originating from either F. graminearum or Zea mays have been cloned and characterized. A summary of the findings will be presented.

254. Genetic diversity of fumonisin-producing isolates of Fusarium moniliforme (Gibberella fujikuroi) in Korea. Sook Young Park, and Yin Won Lee. Seoul National University, Agricultural Biology, Suwon, Kyunggi, South Korea.

Eighteen hundred and fifty two nitrate non-utilizing (nit) mutants were recovered from 130 isolates of Fusarium moniliforme (Teleomorph : Gibberella fujikuroi). The majority (76%) of nit mutants recovered was nit1, followed by NitM (17%) and nit3 (7%). These isolates were grouped into vegetative compatibility groups (VCGs) by demonstrating heterokaryosis using nit mutants. All 130 isolates were paired in all possible pairwise combinations (15,559 combinations) and were divided into 80 nonoverlapping VCGs. VCG analysis of the isolates obtained from a single maize stalk indicated that most maize stalks were infected by more than one isolates of F. moniliforme belong to genetically distinct groups. In the tests of mating population and type, 62 isolates were mating type A+, 29 isolates were A-, 3 isolates were E-, 2 isolates were D-, and 22 isolates were not reproducibly fertile with all mating type testers. Most isolates produced fumonisins and average production levels of fumonisin B1, B2, and B3 were 342, 74, 37 ppm, respectively. Isolates Gf 33, Gf 35, Gf 36, Gf 37, Gf 38 and Gf 40 of F. moniliforme produced high levels of fumonisin B3 compared to B1 or B2. All of these 6 isolates were mating type A+. Moreover, these isolates were grouped in the same VCG 59. Several VC groups were distinguished by amplified DNA band patterns. Furthermore, isolates that produce high levels of fumonisin B3 exhibited the same band pattern by primer OPF09, and these isolates were clearly differentiated from other isolates by RAPD analysis.

255. Analysis of trichothecene gene expression using a defined DNA microarray. Andrew W. Peplow1, Andrew G. Tag1, Tzung-Fu Hsieh2, Terry L. Thomas2, and Marian N. Beremand1. 1Texas A&M; University, Plant Pathology, College Station, TX, USA. 2Texas A&M; University, Biology, College Station, TX, USA.

The trichothecene mycotoxins represent a large group of toxic secondary metabolites produced by a variety of fungi including Fusarium sporotrichioides. The trichothecenes are produced via a complex biosynthetic pathway. Most of the genes responsible for their production are coordinately regulated, and many of them are tightly linked in a cluster. Here we report the construction of a DNA microarray and demonstrate its use to monitor expression of genes involved in trichothecene biosynthesis as well as genes thought to be associated with or affected by trichothecene biosynthesis. To construct the microarray, forty distinct DNA sequences were printed on poly-L-lysine coated microscope slides using a gridding robot. Hybridization of arrays with Cy Dye-labeled cDNA synthesized from poly(A) RNA isolated from wild-type and selected mutant strains spanning different timepoints reveals important information about the regulatory network and components that play a role in trichothecene gene expression and toxin production. Since our data from two microarrays are equivalent to 80 northern analyses, this system offers the opportunity of rapidly assessing qualitative differences in expression of many genes involved specifically with or affected by trichothecene production.

256. Cih1, a biotrophy-related gene expressed at the intracellular interface formed between Colletotrichum lindemuthianum and french bean. Sarah E. Perfect1, Richard J. O'Connell2, and Jon R. Green1. 1University of Birmingham, Biological Sciences, Birmingham, Edgbaston, UK. 2IACR-Long Ashton, University of Bristol, Long Ashton, Bristol, U.K.

Colletotrichum lindemuthianum is a hemibiotrophic ascomycete which causes anthracnose of bean, Phaseolus vulgaris. During the initial biotrophic stage of infection, the fungus differentiates infection vesicles and primary hyphae within host epidermal cells. Monoclonal antibodies (MAbs) have been raised to isolated biotrophic infection structures to facilitate the identification of biotrophy-related molecules. One of these MAbs, designated UB25, recognises a glycoprotein present in the infection peg, and the fungal walls and matrix surrounding the intracellular hyphae. However, the antigen does not appear to be present in secondary necrotrophic hyphae, which suggests that it is specific to the biotrophic stage of the interaction. This glycoprotein may therefore be involved in the establishment and maintenance of biotrophy. The MAb UB25 has been used to immunoscreen a cDNA library constructed from infected bean hypocotyls and positive clones have been isolated and sequenced (Perfect et al., 1998. The Plant Journal 15(2): 273-279). Southern analysis indicates that the CIH1 glycoprotein recognised by UB25 is fungally encoded. Analysis of the deduced amino acid sequence of revealed the presence of two distinct domains, one of which is proline-rich and contains short repetitive motifs with tyrosine-lysine pairs. Tyrosine residues have been implicated in the oxidative cross-linking of plant cell-wall glycoproteins such as extensins. Cross-linking studies of CIH1 indicate that this glycoprotein has the potential to be oxidatively cross-linked by peroxidase in the presence of hydrogen peroxide. CIH1 homologues have been identified in a range of Colletotrichum species by Southern analysis. The expression patterns of these homologues in other fungal-plant interactions has been investigated by northern analysis and indirect immunofluorescence using UB25. Gene replacement studies are underway to assess the functional importance of CIH1.

257.A polyketide synthase gene required for the biosynthesis of fumonisin mycotoxins in Gibberella fujikuroi Mating PopulationA. Robert H. Proctor, Anne E. Desjardins, Ronald D. Plattner, and Thomas M. Hohn. USDA ARS NCAUR , Mycotoxin Research Unit, Peoria, Illinois, USA.

Fumonisins are toxins produced by the maize pathogen Gibberella fujikuroi mating population A (MP-A) and are associated with mycotoxicoses in both humans and animals. Structural and precursor feeding studies indicate fumonisins are products of either polyketide or fatty acid metabolism. We attempted to isolate a polyketide synthase (PKS) gene involved in fumonisin biosynthesis via PCR with degenerate PKS primers and a cDNA template prepared from a fumonisin-producing culture of G. fujikuroi. Nucleotide sequence analysis of the single PCR product and flanking DNA from a cosmid clone revealed a gene (FUM5) with a 7.8 kb coding region interrupted by 5 introns. The predicted FUM5 translation product had conserved amino acid sequences indicative of the ketoacyl synthase, acyl transferase, ketoacyl reductase, dehydratase, enoyl reductase, and acyl carrier protein domains present in Type I bacterial and fungal PKSs. Transformation of a cosmid clone that included FUM5 into G. fujikuroi increased the levels of production in three strains and restored wild-type production in a fumonisin-nonproducing strain. Disruption of FUM5 reduced fumonisin production by over 99% in G. fujikuroi MP-A. These results indicate that FUM5 is a PKS gene required for fumonisin biosynthesis and, further, that fumonisins are primarily products of polyketide rather than fatty acid metabolism.

258. Expressed sequence tag analysis of gene expression in Phytophthora sojae. Dinah Qutob1, and Mark Gijzen2. 1University of Western Ontario, Microbiology and Immunol, London, Ontario, Canada. 2Agriculture Canada, London, Ontario, Canada.

Phytophthora sojae is an oomycete pathogen that causes stem and root rot on soybean plants. We have constructed three cDNA libraries using mRNA isolated from axenically grown mycelia and zoospores, and tissue isolated from plant hypocotyls 48 h after inoculation with zoospores. More than one thousand expressed sequence tags (ESTs) were generated from each library. The ESTs were compared to existing sequences in the NCBI database by BLASTX searches. The resulting hits were assigned to functional categories and the distribution of the ESTs were compared for each source library. Distinct expression patterns were observed for each library. Although it is not possible to unequivocally distinguish P.sojae from soybean ESTs in the infected plant library, we have found that the G+C content of the sequence provides a useful measure for this purpose. When ESTs are classified based upon G+C content and plotted according to frequency, normal distributions are observed for ESTs from axenically grown P. sojae (58.1% mean G+C) or soybean (45.9% mean G+C). In contrast, a binomial distribution of two distinct populations of clones are present in the infected plant library. We estimate that 60 to 70% of the ESTs from the infected plant library are derived from P. sojae cDNA transcripts. P. sojae has always been considered an aggressive and fast growing pathogen, nonetheless, this very high representation of pathogen genes in the infected plant library is surprising.

259. Understanding fungal symbiotic lifestyles: Isolation of pathogenicity genes from Colletotrichum species and deciphering the basis of plant protection afforded by non-pathogenic mutants. Regina S. Redman, and Rusty J. Rodriguez. USGS, BRD, Seattle, WA, USA.

Previously, we isolated and characterized a mutant (path-1) of C. magna which does not elicit disease symptoms but retains the ability to infect and grow through host tissues. In addition, plants colonized with path-1 are protected from disease caused by C. magna, C. orbiculare, and Fusarium oxysporum. Disease protection in this system is localized, tissue specific, and is correlated to a rapid and strong activation of host defenses when path-1 colonized plants are exposed to virulent fungi. To begin deciphering the genetic complexity of pathogenicity, we isolated 176 non-pathogenic mutants of C. magna by DNA disruption using restriction enzyme mediated integrative (REMI) transformation. Collectively, these mutants express three phenotypes: A - colonization and full protection of watermelon plants against virulent fungi, B - colonization and partial protection of plants against virulent fungi, and C - colonization and no protection of plants against virulent fungi. Molecular and segregation analysis of two non-pathogenic REMI mutants (R1 and R21) indicated that these non-pathogenic phenotypes resulted from integration of the transformation vector into single sites in the fungal genomes. Recently, we cloned the integrated vector and 4.5 kb of flanking DNA from REMI mutant R1. To verify that the cloned DNA, designated pGMR1, contained a pathogenicity gene, pGMR1 was transformed into a wild type (wt) isolate in an attempt to induce gene disruptions. 47% of the pGMR1 transformants (Tx's) were nonpathogenic on watermelon seedlings and expressed the same phenotype as the R1 mutant.

260. The homoserine utilization gene from a CD chromosome of Nectria haematococca: a habitat-defining gene? Marianela C. Rodriguez, Esteban D. Temporini, Catherine C. Wasmann, and Hans D. Van Etten. University of Arizona, Plant Pathology, Tucson, Arizona, USA..The species Nectria haematococca mating population VI exists in a wide range of habitats although individual isolates have a limited habitat range. Previous research from our lab has indicated that part of this habitat diversity is due to the presence of supernumerary chromosomes that contain unique habitat defining genes. Since these chromosomes are not needed for axenic growth but are important for habitat specificity, they have been called "Conditionally Dispensable" (CD) chromosomes. One of these CD chromosomes contains a cluster of genes for pathogenicity on pea called the PEP cluster (for pea pathogenicity). In the current study we show that all isolates pathogenic on pea are able to utilize homoserine as a sole carbon and nitrogen source. Homoserine is one of the chemicals present in larger amounts in pea root exudates. We found that the homoserine utilization gene (HUT) is located on the same CD chromosome that contains the PEP cluster but is not part of this cluster. Preliminary results comparing near isogenic strains differing in the region of the CD chromosome containing HUT show that an isolate with this region has a competitive advantage in the pea rhizosphere. Cosmid clones containing HUT have been identified by complementation of homoserine utilization in Neurospora crassa. Once HUT has been isolated we will determine if it is an additional habitat-defining gene on the CD chromosome.

261. Involvement of cAMP and pH in signaling sclerotial development and oxalic acid production in Sclerotinia sclerotiorum. Jeffrey A. Rollins. University of Nebraska, Plant Pathology, Lincoln, NE, USA.

Sclerotinia sclerotiorum is a broad host range, filamentous, plant pathogen which produces oxalic acid (OA), an essential pathogenicity determinant. Previously, we isolated mutants which are deficient in both OA production and sclerotial development and demonstrated that elevated levels of cAMP increase OA production and inhibit sclerotial development. We are interested in further characterizing the molecular signaling pathways which may link these secondary metabolic and developmental pathways. We now demonstrate that ambient pH also plays a role in regulating OA production and sclerotial development. Similar to the effects of high cAMP, neutral or alkaline ambient pH inhibits sclerotial development while increasing OA production. To examine the roles of pH-dependent and cAMP-dependent signaling in sclerotial development and OA biosynthesis we are cloning and characterizing genes which encode components of these signaling pathways. We have cloned and characterized the sequence of a gene encoding the catalytic subunit of cAMP-dependent protein kinase A (PKA-S) from S. sclerotiorum. Functional analysis of this gene is being carried out by targeted gene disruption and by constitutive overexpression. Characterization of transformants from targeted gene disruption experiments will be reported. The first step towards overexpressing PKA-S, the identification of a constitutive promoter driving reporter gene expression in S. sclerotiorum, has been accomplished. This reporter gene system utilizes the toxA promoter (Ciuffetti et al. 1997. Plant Cell 9:135-144) to drive GFP expression. Characterization of GFP expression in S. sclerotiorum and efforts to clone genes involved in ambient pH signaling will be presented.

262. Phycomyces genes for the metabolism of 3-hydroxy-3-methylglutaryl-Coenzyme A.Javier Ruiz-Albert, Enrique Cerdá-Olmedo, and Luis M. Corrochano. Universidad de Sevilla, Departamento de Genetica, Sevilla, Sevilla, Spain.

Terpenoids form a chemical family that includes sterols, carotenoids, and gibberellins. All terpenoids share the early biosynthetic steps, including the synthesis of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) and its conversion to mevalonate. These two steps are catalized by the enzymes HMG-CoA synthase (HMGS) and HMG-CoA reductase (HMGR), respectively. The Zygomycete Phycomyces blakesleeanus has been a subject for research of carotene biosynthesis. We have cloned and sequenced the Phycomyces genes hmgS and hmgR, encoding HMG-CoA synthase and HMG-CoA reductase, respectively. Gene hmgR is 3.9 kb long and encodes a protein of 1171 aminoacids with a transmembrane domain, a linker, and a cytoplasmic catalytic domain. The first has eigth predicted transmembrane segments. The catalytic domain of Phycomyces HMGR is very similar to that of other fungi. The hmgS gene encodes a cytoplasmic protein of 473 amino acids. Phycomyces contains a single hmgR gene and a single hmgS gene, as judged from Southern hybridizations. The hmgR gene is expressed at similar levels throughout vegetative growth. The catalytic domain of HMGR has been overexpressed and the resulting protein has been purified and characterized. Mutants with an increased carotene biosynthesis accumulate more hmgS and hmgR mRNAs than the wild type. These genes are used to determine the mechanisms of action of external agents and mutations that modify carotene biosynthesis.

263. Monitoring structural changes in heterogeneous populations of the head blight pathogen Fusarium culmorum with molecular fingerprint markers . Angela G. Schilling 1, Thomas Miedaner 2, and Hartwig H. Geiger 1. 1University of Hohenheim, Institute of Plant Breeding, Seed Sciences and Population Genetics, and 2 State Plant Breeding Institute, D-70593 Stuttgart, Germany.

Fusarium culmorum is a phytopathogenic and mycotoxigenic fungal species causing ear and foot rot diseases of cereals world-wide. Genetic variation has been described for aggressiveness, mycotoxin production, and molecular markers among isolates from diverse habitats and individual field populations. In this study, field experiments were conducted to analyse changes in the composition of isolate mixtures as a function of aggressiveness, mycotoxin production of the mixture components and host resistance. Pairs of isolates expressing similar or contrary levels of aggressiveness and different types of mycotoxins were inoculated onto two rye genotypes at anthesis. Host resistance differed between the rye genotypes. All isolates were also inoculated individually. The low aggressive isolates produced nivalenol and the high aggressive ones deoxynivalenol. At the onset of infection, pathogen genotypes were re-isolated from ears and identified with RAPD markers characteristic for the isolates used. On both rye genotypes, disease severities and yield reduction assessed as aggressiveness measures were significantly lower following infection with mixtures than with single isolates. Thus, competition between fungal genotypes may have occurred explaining the weaker colonization of the host. The ratios of re-isolated genotypes from mixed infections deviated significantly from 1:1 when a particularly high aggressive isolate was inoculated together with either a lower or similarly high aggressive one. Similar observations were made with mixtures of a particular low aggressive isolate indicating that pathogen genotypes display additional fitness characteristics other than aggressiveness. Changes in the composition of fungal populations were also inferred from analysing mycotoxin profiles and accumulation in the harvested grain.

264. The role of BcatrB , a new ATP-binding cassette transporter, in pathogenesis of Botrytis cinerea.Henk-jan Schoonbeek1, Giovanni Del Sorbo2 and Maarten A. De Waard1, 1 Laboratory of Phytopathology, Wageningen Agricultural University. P.O. Box 8025, 6700 EE Wageningen, The Netherlands. 2 Institute of Plant Pathology, Via Università, 100, 80055 Portici (Naples) Italy.

ATP-binding cassette (ABC) transporters are membrane transport ATPases which may play a role in the secretion of exogenous toxic products. We propose that in plant pathogens these transporters can be involved in the secretion of toxic plant defence products which accumulate in fungal cells upon colonisation of plant tissue. In addition, ABC-transporters may function in secretion of fungal pathogenicity factors. We study the role of ABC-transporters in pathogenesis of Botrytis cinerea. Two homologues of PDR5, a gene involved in pleiotropic drug resistance in yeast, have been isolated from a genomic library of B. cinerea strain SAS56. The sequences of the genes BcatrA and BcatrB predict proteins with a (NBF-TMD)2 organisation and a length of 1562 and 1439 amino acids, respectively. The inducing activity of several fungitoxic compounds of natural and synthetic origin was tested using Northern blot analysis. Only cycloheximide induced BcatrA Its effect on the expression of BcatrB was weak. Interestingly, this gene was strongly induced by the grapevine phytoalexin resveratrol. Neither of the genes was induced by other plant defence compounds tested (pisatin, tomatin and quercetin) at physiological concentrations. Knock-out mutants of both genes were made by replacement of the major part of the coding region by a hygromycin resistance cassette. No phenotype could be determined for DBcatrA mutants. However, DBcatrB mutants proved to be more sensitive to resveratrol. These results indicate that BcatrB plays a role in protection of the fungus against resveratrol and possibly other plant defence compounds which have not been tested yet.

265. Genetic transformation of the basidiomycete Trametes versicolor.Frank Schuren, Hannie Hessing, Marian van Muijlwijk, Cora van Zeijl, Rupert Pfaller1 and Cees van den Hondel. TNO Nutrition & Food Research Institute, P.O. Box 360, 3700 AJ Zeist, The Netherlands 1Consortium für Elektrochemische Industrie, München, Germany.

The basidiomycete Trametes versicolor has the ability to secrete significant amounts of laccase into its growth medium. Increased expression of a T. versicolor laccase gene in Aspergillus niger turned out to be problematical. Therefore, a transformation system was developed for T. versicolor to enable homologous expression. By using FOA-selection a pyrG mutant was isolated which could be transformed with the Schizophyllum commune ura1 gene. Transformation frequencies were rather low but the addition of restriction enzymes during transformation (REMI) and the fusion of the ura1 coding sequence to the T. versicolor gpd promoter resulted in an enormously increased transformation frequency, up to 30 transformants µg-1 DNA. Overexpression of laccase was tested both by analyzing transformants containing multiple copies of the laccase genomic clone and by analyzing transformants containing gpd promoter driven laccase constructs. A simple plate assay was developed for quick analysis of transformants. Best expression was found in transformants containing gpd promoter driven laccase constructs. Laccase expression in liquid cultures of well-expressing transformants was 5-10 higher compared to non-transformed strains.

266. Analysis of xylanase and pectinase genes in Cochliobolus carbonum. John S. Scott-Craig, Nyerhovwo J. Tonukari, Sigrun Wegener, and Jonathan D. Walton. Michigan State University, DOE Plant Research Lab, East Lansing, Michigan, USA.

The maize pathogen Cochliobolus carbonum secretes a large number of plant-cell-wall-degrading enzymes when grown with maize cells walls as the sole carbon source. Xylan-containing polymers constitute almost 50% of the dry weight of the maize cell wall while pectin constitutes about six percent. At least five xylan-degrading and three pectin-degrading enzymes are produced by the fungus. Genes encoding four endo-xylanases (XYL1,2,3,4), one ß-xylosidase (XYP1), an endo-polygalacturonase (PGN1), an exo-polygalacturonase (PGX1) and a pectin methylesterase (PME1) have been cloned and used to create strains containing deletions of each gene. These deletions, singly and in combination, are being examined for their effects on the growth of the fungus in vitro on xylan and pectin and on the ability of the fungus to infect maize.

267. Factors affecting pathogenicity of Metarhizium anisopliae. Steven E. Screen, and Ray J. St. Leger. University of Maryland, Entomology, College Park, MD, USA.

Infection by Metarhizium anisopliae requires a precise sequence of events, encompassing spore adhesion, germ-tube development, appressorium formation, penetration, and directed growth down through the insect cuticle. We have been studying the host-related signals that direct this development/differentiation using the co-ordinated formation of infection structures and secretion of the major cuticle degrading protease (PR1) as our models. A complex interaction between the fungus and host, involving the topography and hydrophobicity of the cuticular surface, and the concentration and nature of available nutrients, ultimately determines whether a pathogenic interaction is established. These primary host related signals are transmitted into the cell via second messengers (cAMP and Ca 2+ ) causing changes in the expression/activity of both global (eg. CRR1 and NRR1) and pathogenicity specific transcription regulator proteins. Response to host signals is also influenced by pH which can override the inductive effects of cuticle components.

268. Characterisation of a gene encoding cyanide hydratase in the phytopathogenic fungus Leptosphaeria maculans .Adrienne C. Sexton, and Barbara J. Howlett. The University of Melbourne, Botany, Parkville, Vic, Australia.

A gene encoding cyanide hydratase from Leptosphaeria maculans, an ascomycete which causes blackleg disease of oilseed Brassica spp. has been cloned. The predicted amino acid sequence of this single copy gene is 77% and 82% identical to cyanide hydratase from phytopathogenic fungi Gloeocercospora sorghi and Fusarium lateritium, respectively. This enzyme catalyses the breakdown of hydrogen cyanide to a less toxic compound, formamide. The cyanide hydratase gene is induced strongly in vitro by 0.1 mM KCN, and slightly in the presence of 1 mM 2-propenyl glucosinolate, the major glucosinolate of Brassica juncea, plus a plant enzyme, myrosinase (which catalyses glucosinolate hydrolysis). This finding suggests that HCN may be released during glucosinolate breakdown in B. juncea. Levels of HCN released from macerated leaves of B. juncea and B. napus, and from 2-propenyl glucosinolate hydrolysis were measured. No HCN was detected from 2-propenyl glucosinolate or from B. juncea leaves, however, a small amount (25 nmol/g fresh weight) was released from B. napus leaves. B. napus has a high content of hydroxy aliphatic glucosinolates, which yield hydroxynitriles upon hydrolysis, and in other plants hydroxynitriles breakdown to HCN. Therefore, L. maculans may need to detoxify HCN during infection of B. napus. Transcription of cyanide hydratase is detectable in infected cotyledons of B. juncea and B. napus, but the role of this gene in the infection process is unclear.